EMAIL THIS PAGE TO A FRIEND

EML6

echinoderm microtubule associated protein like 6

112 Gene Product Result for
UniProtKB ID: Q6ZMW3, A8MUB5, B6ZDG7
Gene ID:
Mouse(237711) echinoderm microtubule associated protein like 6
Rat(498429) echinoderm microtubule associated protein like 6
sheep(101101879) echinoderm microtubule associated protein like 6
Domestic Rabbit(100346951) echinoderm microtubule associated protein like 6
domestic guinea pig(100715222) echinoderm microtubule associated protein like 6
naked mole-rat(101713802) echinoderm microtubule associated protein like 6
Zebrafish(100000931) echinoderm microtubule associated protein like 6
cow(516921) echinoderm microtubule associated protein like 6
Horse(100066629) echinoderm microtubule associated protein like 6
domestic cat(101091187) echinoderm microtubule associated protein like 6
dog(481373) echinoderm microtubule associated protein like 6
chicken(421215) echinoderm microtubule associated protein like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039753 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068221 MISSION® esiRNA esiRNA targeting mouse C230094A16Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039753 Rosetta Predictions human pricing
XM_001725001 Rosetta Predictions human pricing
XM_001725002 Rosetta Predictions human pricing
XM_001725718 Rosetta Predictions human pricing
XM_001725719 Rosetta Predictions human pricing
XM_001726920 Rosetta Predictions human pricing
XM_001726921 Rosetta Predictions human pricing
XM_573680 Rosetta Predictions rat pricing
NM_146016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105922 predicted 324
2 SASI_Hs01_00105923 predicted 1720
3 SASI_Hs01_00105924 predicted 671
4 SASI_Hs01_00105925 predicted 1732
5 SASI_Hs01_00105926 predicted 466
6 SASI_Hs01_00105927 predicted 681
7 SASI_Hs01_00105928 predicted 878
8 SASI_Hs01_00105929 predicted 890
9 SASI_Hs01_00105930 predicted 1710
10 SASI_Hs01_00105931 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00464944 predicted 5090
2 SASI_Hs02_00464945 predicted 874
3 SASI_Hs02_00464946 predicted 5565
4 SASI_Hs02_00464947 predicted 5412
5 SASI_Hs02_00464948 predicted 1393
6 SASI_Hs02_00464949 predicted 1762
7 SASI_Hs02_00464950 predicted 5467
8 SASI_Hs02_00464951 predicted 5497
9 SASI_Hs02_00464952 predicted 1460
10 SASI_Hs02_00464953 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00464954 predicted 5000
2 SASI_Hs02_00464955 predicted 880
3 SASI_Hs02_00464956 predicted 5477
4 SASI_Hs02_00464957 predicted 5314
5 SASI_Hs02_00464958 predicted 1400
6 SASI_Hs02_00464959 predicted 1766
7 SASI_Hs02_00464960 predicted 5379
8 SASI_Hs02_00464961 predicted 5402
9 SASI_Hs02_00464962 predicted 1475
10 SASI_Hs02_00464963 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469528 predicted 5096
2 SASI_Hs02_00469529 predicted 874
3 SASI_Hs02_00469530 predicted 5568
4 SASI_Hs02_00469531 predicted 5406
5 SASI_Hs02_00469532 predicted 1389
6 SASI_Hs02_00469533 predicted 1761
7 SASI_Hs02_00469534 predicted 5464
8 SASI_Hs02_00469535 predicted 5497
9 SASI_Hs02_00469536 predicted 1457
10 SASI_Hs02_00469537 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469538 predicted 5002
2 SASI_Hs02_00469539 predicted 874
3 SASI_Hs02_00469540 predicted 5472
4 SASI_Hs02_00469541 predicted 5319
5 SASI_Hs02_00469542 predicted 1404
6 SASI_Hs02_00469543 predicted 1772
7 SASI_Hs02_00469544 predicted 5376
8 SASI_Hs02_00469545 predicted 5408
9 SASI_Hs02_00469546 predicted 1470
10 SASI_Hs02_00469547 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477395 predicted 5094
2 SASI_Hs02_00477396 predicted 876
3 SASI_Hs02_00477397 predicted 5569
4 SASI_Hs02_00477398 predicted 5414
5 SASI_Hs02_00477399 predicted 1385
6 SASI_Hs02_00477400 predicted 1757
7 SASI_Hs02_00477401 predicted 5463
8 SASI_Hs02_00477402 predicted 5500
9 SASI_Hs02_00477403 predicted 1454
10 SASI_Hs02_00477404 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477405 predicted 5001
2 SASI_Hs02_00477406 predicted 876
3 SASI_Hs02_00477407 predicted 5481
4 SASI_Hs02_00477408 predicted 5312
5 SASI_Hs02_00477409 predicted 1404
6 SASI_Hs02_00477410 predicted 1768
7 SASI_Hs02_00477411 predicted 5378
8 SASI_Hs02_00477412 predicted 5408
9 SASI_Hs02_00477413 predicted 1470
10 SASI_Hs02_00477414 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400627 predicted 2182
2 SASI_Rn02_00400628 predicted 2127
3 SASI_Rn02_00400629 predicted 2193
4 SASI_Rn02_00400630 predicted 1889
5 SASI_Rn02_00400631 predicted 2106
6 SASI_Rn02_00400632 predicted 622
7 SASI_Rn02_00400633 predicted 697
8 SASI_Rn02_00400634 predicted 1817
9 SASI_Rn02_00400635 predicted 2149
10 SASI_Rn02_00400636 predicted 2057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341571 predicted 1599
2 SASI_Mm02_00341572 predicted 4244
3 SASI_Mm02_00341573 predicted 4537
4 SASI_Mm02_00341574 predicted 2221
5 SASI_Mm02_00341575 predicted 927
6 SASI_Mm02_00341576 predicted 4069
7 SASI_Mm02_00341577 predicted 4793
8 SASI_Mm02_00341578 predicted 2577
9 SASI_Mm02_00341579 predicted 4578
10 SASI_Mm02_00341580 predicted 6053
11 SASI_Mm01_00048976 predicted 1613
12 SASI_Mm01_00048977 predicted 1580
13 SASI_Mm01_00048978 predicted 1256
14 SASI_Mm01_00048979 predicted 1254
15 SASI_Mm01_00048980 predicted 1483
16 SASI_Mm01_00048981 predicted 630
17 SASI_Mm01_00048982 predicted 1354
18 SASI_Mm01_00048983 predicted 623
19 SASI_Mm01_00048984 predicted 638
20 SASI_Mm01_00048985 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146016
EML6 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146016.1-927s1c1
Sequence:CCGGGCTTATTGTGACTGGCGGAAACTCGAGTTTCCGCCAGTCACAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1644s1c1
Sequence:CCGGGAAGCAAGTAACTGAAGCCATCTCGAGATGGCTTCAGTTACTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1481s1c1
Sequence:CCGGCAGTTGACTTCTATGACCTTACTCGAGTAAGGTCATAGAAGTCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1260s1c1
Sequence:CCGGGAAACTGTTAAACAAGGTGAACTCGAGTTCACCTTGTTTAACAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146016.1-2257s1c1
Sequence:CCGGCCTAACCAATATGTAGCGTTTCTCGAGAAACGCTACATATTGGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216064    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146016.2-7864s1c1
Sequence:CCGGCAACTGACTAATCAATGATATCTCGAGATATCATTGATTAGTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146016.2-7340s1c1
Sequence:CCGGGATGATTAATGCAGGGTAAATCTCGAGATTTACCCTGCATTAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146016
EML6 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146016.1-927s1c1
Sequence:CCGGGCTTATTGTGACTGGCGGAAACTCGAGTTTCCGCCAGTCACAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1644s1c1
Sequence:CCGGGAAGCAAGTAACTGAAGCCATCTCGAGATGGCTTCAGTTACTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1481s1c1
Sequence:CCGGCAGTTGACTTCTATGACCTTACTCGAGTAAGGTCATAGAAGTCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1260s1c1
Sequence:CCGGGAAACTGTTAAACAAGGTGAACTCGAGTTCACCTTGTTTAACAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146016.1-2257s1c1
Sequence:CCGGCCTAACCAATATGTAGCGTTTCTCGAGAAACGCTACATATTGGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216064    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146016.2-7864s1c1
Sequence:CCGGCAACTGACTAATCAATGATATCTCGAGATATCATTGATTAGTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146016.2-7340s1c1
Sequence:CCGGGATGATTAATGCAGGGTAAATCTCGAGATTTACCCTGCATTAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146016
EML6 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146016.1-927s1c1
Sequence:CCGGGCTTATTGTGACTGGCGGAAACTCGAGTTTCCGCCAGTCACAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1644s1c1
Sequence:CCGGGAAGCAAGTAACTGAAGCCATCTCGAGATGGCTTCAGTTACTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1481s1c1
Sequence:CCGGCAGTTGACTTCTATGACCTTACTCGAGTAAGGTCATAGAAGTCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146016.1-1260s1c1
Sequence:CCGGGAAACTGTTAAACAAGGTGAACTCGAGTTCACCTTGTTTAACAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146016.1-2257s1c1
Sequence:CCGGCCTAACCAATATGTAGCGTTTCTCGAGAAACGCTACATATTGGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216064    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146016.2-7864s1c1
Sequence:CCGGCAACTGACTAATCAATGATATCTCGAGATATCATTGATTAGTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146016.2-7340s1c1
Sequence:CCGGGATGATTAATGCAGGGTAAATCTCGAGATTTACCCTGCATTAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039753
EML6 MISSION shRNA Bacterial Glycerol Stock
echinoderm microtubule associated protein like 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-223s21c1
Sequence:CCGGTGGGACACAACGACGACATTACTCGAGTAATGTCGTCGTTGTGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039753.2-6250s21c1
Sequence:CCGGTCGGTTACCCTAACCAATATGCTCGAGCATATTGGTTAGGGTAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-1613s21c1
Sequence:CCGGCAACTCAGTGGATGCGAATTACTCGAGTAATTCGCATCCACTGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039753.2-6222s21c1
Sequence:CCGGATGTAGCCCGCTGACGAATTTCTCGAGAAATTCGTCAGCGGGCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-4560s21c1
Sequence:CCGGGGTCACCTGGAGCGCATATTTCTCGAGAAATATGCGCTCCAGGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-3621s21c1
Sequence:CCGGAGCGATATAACTGACGTAAATCTCGAGATTTACGTCAGTTATATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-3514s21c1
Sequence:CCGGCAAGAGGCAAACGGCATATAACTCGAGTTATATGCCGTTTGCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-290s21c1
Sequence:CCGGAGTCGGGAAGGAGCCATATATCTCGAGATATATGGCTCCTTCCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039753
EML6 MISSION shRNA shRNA Plasmid DNA
echinoderm microtubule associated protein like 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-223s21c1
Sequence:CCGGTGGGACACAACGACGACATTACTCGAGTAATGTCGTCGTTGTGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039753.2-6250s21c1
Sequence:CCGGTCGGTTACCCTAACCAATATGCTCGAGCATATTGGTTAGGGTAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-1613s21c1
Sequence:CCGGCAACTCAGTGGATGCGAATTACTCGAGTAATTCGCATCCACTGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039753.2-6222s21c1
Sequence:CCGGATGTAGCCCGCTGACGAATTTCTCGAGAAATTCGTCAGCGGGCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-4560s21c1
Sequence:CCGGGGTCACCTGGAGCGCATATTTCTCGAGAAATATGCGCTCCAGGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-3621s21c1
Sequence:CCGGAGCGATATAACTGACGTAAATCTCGAGATTTACGTCAGTTATATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-3514s21c1
Sequence:CCGGCAAGAGGCAAACGGCATATAACTCGAGTTATATGCCGTTTGCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-290s21c1
Sequence:CCGGAGTCGGGAAGGAGCCATATATCTCGAGATATATGGCTCCTTCCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039753
EML6 MISSION shRNA Lentiviral Transduction Particles
echinoderm microtubule associated protein like 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-223s21c1
Sequence:CCGGTGGGACACAACGACGACATTACTCGAGTAATGTCGTCGTTGTGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039753.2-6250s21c1
Sequence:CCGGTCGGTTACCCTAACCAATATGCTCGAGCATATTGGTTAGGGTAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-1613s21c1
Sequence:CCGGCAACTCAGTGGATGCGAATTACTCGAGTAATTCGCATCCACTGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039753.2-6222s21c1
Sequence:CCGGATGTAGCCCGCTGACGAATTTCTCGAGAAATTCGTCAGCGGGCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-4560s21c1
Sequence:CCGGGGTCACCTGGAGCGCATATTTCTCGAGAAATATGCGCTCCAGGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-3621s21c1
Sequence:CCGGAGCGATATAACTGACGTAAATCTCGAGATTTACGTCAGTTATATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-3514s21c1
Sequence:CCGGCAAGAGGCAAACGGCATATAACTCGAGTTATATGCCGTTTGCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039753.2-290s21c1
Sequence:CCGGAGTCGGGAAGGAGCCATATATCTCGAGATATATGGCTCCTTCCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)