EMAIL THIS PAGE TO A FRIEND

EMP1

epithelial membrane protein 1

168 Gene Product Result for
Synonyms: CL-20 EMP-1 TMP
UniProtKB ID: P54849, B2R5N1, O00681, Q13481, Q13834
Gene ID:
Mouse(13730) epithelial membrane protein 1
Rat(25314) epithelial membrane protein 1
Zebrafish(100318165) epithelial membrane protein 1
dog(486676) epithelial membrane protein 1
cow(786490) epithelial membrane protein 1
domestic cat(101094110) epithelial membrane protein 1
chicken(417964) epithelial membrane protein 1
sheep(101109432) epithelial membrane protein 1
Domestic Rabbit(100009209) epithelial membrane protein 1
naked mole-rat(101724175) epithelial membrane protein 1
domestic guinea pig(100731563) epithelial membrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001423 Rosetta Predictions human pricing
NM_012843 Rosetta Predictions rat pricing
NM_010128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244200 predicted 554
2 SASI_Hs01_00244201 predicted 1148
3 SASI_Hs01_00244202 predicted 254
4 SASI_Hs01_00244204 predicted 252
5 SASI_Hs01_00244205 predicted 399
6 SASI_Hs01_00244206 predicted 251
7 SASI_Hs01_00244207 predicted 289
8 SASI_Hs01_00244208 predicted 563
9 SASI_Hs02_00331826 predicted 1006
10 SASI_Hs02_00331827 predicted 643
11 SASI_Hs01_00244203 predicted 520
12 SASI_Hs01_00244209 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102631 predicted 993
2 SASI_Rn01_00102632 predicted 415
3 SASI_Rn02_00260310 predicted 1086
4 SASI_Rn01_00102634 predicted 1025
5 SASI_Rn01_00102636 predicted 1055
6 SASI_Rn02_00260311 predicted 1080
7 SASI_Rn01_00102637 predicted 1039
8 SASI_Rn02_00260312 predicted 382
9 SASI_Rn01_00102639 predicted 1011
10 SASI_Rn01_00102640 predicted 330
11 SASI_Rn01_00102633 predicted 360
12 SASI_Rn01_00102635 predicted 476
13 SASI_Rn01_00102638 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128328 predicted 1179
2 SASI_Mm02_00317849 predicted 243
3 SASI_Mm02_00317850 predicted 477
4 SASI_Mm01_00128329 predicted 287
5 SASI_Mm01_00128330 predicted 534
6 SASI_Mm01_00128332 predicted 206
7 SASI_Mm01_00128333 predicted 534
8 SASI_Mm01_00128337 predicted 1045
9 SASI_Mm01_00128334 predicted 299
10 SASI_Mm01_00128336 predicted 1080
11 SASI_Mm01_00128331 predicted 252
12 SASI_Mm01_00128335 predicted 1120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001423
EMP1 MISSION shRNA Bacterial Glycerol Stock
epithelial membrane protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001423.2-1129s21c1
Sequence:CCGGCTTTGTGCTGAATACGCTAAGCTCGAGCTTAGCGTATTCAGCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001423.2-392s21c1
Sequence:CCGGTGCAGTGACAGCCTGTCATATCTCGAGATATGACAGGCTGTCACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001423.2-912s21c1
Sequence:CCGGGTAGTTGGCTAGTACTTTGATCTCGAGATCAAAGTACTAGCCAACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001423.1-1213s1c1
Sequence:CCGGCCCTCTTTGGAACAGATATTTCTCGAGAAATATCTGTTCCAAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-257s1c1
Sequence:CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-251s1c1
Sequence:CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-595s1c1
Sequence:CCGGCGCAGTATCACCACGGCTATTCTCGAGAATAGCCGTGGTGATACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-555s1c1
Sequence:CCGGGTGTCCATCTACACTAGTCATCTCGAGATGACTAGTGTAGATGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001423
EMP1 MISSION shRNA shRNA Plasmid DNA
epithelial membrane protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001423.2-1129s21c1
Sequence:CCGGCTTTGTGCTGAATACGCTAAGCTCGAGCTTAGCGTATTCAGCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001423.2-392s21c1
Sequence:CCGGTGCAGTGACAGCCTGTCATATCTCGAGATATGACAGGCTGTCACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001423.2-912s21c1
Sequence:CCGGGTAGTTGGCTAGTACTTTGATCTCGAGATCAAAGTACTAGCCAACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001423.1-1213s1c1
Sequence:CCGGCCCTCTTTGGAACAGATATTTCTCGAGAAATATCTGTTCCAAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-257s1c1
Sequence:CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-251s1c1
Sequence:CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-595s1c1
Sequence:CCGGCGCAGTATCACCACGGCTATTCTCGAGAATAGCCGTGGTGATACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-555s1c1
Sequence:CCGGGTGTCCATCTACACTAGTCATCTCGAGATGACTAGTGTAGATGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001423
EMP1 MISSION shRNA Lentiviral Transduction Particles
epithelial membrane protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001423.2-1129s21c1
Sequence:CCGGCTTTGTGCTGAATACGCTAAGCTCGAGCTTAGCGTATTCAGCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001423.2-392s21c1
Sequence:CCGGTGCAGTGACAGCCTGTCATATCTCGAGATATGACAGGCTGTCACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001423.2-912s21c1
Sequence:CCGGGTAGTTGGCTAGTACTTTGATCTCGAGATCAAAGTACTAGCCAACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001423.1-1213s1c1
Sequence:CCGGCCCTCTTTGGAACAGATATTTCTCGAGAAATATCTGTTCCAAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-257s1c1
Sequence:CCGGCGCTACTGTTATTATGCTATTCTCGAGAATAGCATAATAACAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-251s1c1
Sequence:CCGGCCACATCGCTACTGTTATTATCTCGAGATAATAACAGTAGCGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-595s1c1
Sequence:CCGGCGCAGTATCACCACGGCTATTCTCGAGAATAGCCGTGGTGATACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001423.1-555s1c1
Sequence:CCGGGTGTCCATCTACACTAGTCATCTCGAGATGACTAGTGTAGATGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010128
VALIDATED
EMP1 MISSION shRNA Bacterial Glycerol Stock
epithelial membrane protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010128.4-1577s21c1
Sequence:CCGGGCACTCAATGTATCTTGTATACTCGAGTATACAAGATACATTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-366s21c1
Sequence:CCGGCCTACGGCAATGAAGATGCTACTCGAGTAGCATCTTCATTGCCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-543s21c1
Sequence:CCGGTGTCAATCTACACTCATCATTCTCGAGAATGATGAGTGTAGATTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-457s21c1
Sequence:CCGGCCAGCTCTTCACTATGGAGAACTCGAGTTCTCCATAGTGAAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-1580s1c1
Sequence:CCGGGCACTCAATGTATCTTGTATACTCGAGTATACAAGATACATTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010128.3-366s1c1
Sequence:CCGGCCTACGGCAATGAAGATGCTACTCGAGTAGCATCTTCATTGCCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-543s1c1
Sequence:CCGGTGTCAATCTACACTCATCATTCTCGAGAATGATGAGTGTAGATTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-542s1c1
Sequence:CCGGGTGTCAATCTACACTCATCATCTCGAGATGATGAGTGTAGATTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010128.3-457s1c1
Sequence:CCGGCCAGCTCTTCACTATGGAGAACTCGAGTTCTCCATAGTGAAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010128
VALIDATED
EMP1 MISSION shRNA shRNA Plasmid DNA
epithelial membrane protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010128.4-1577s21c1
Sequence:CCGGGCACTCAATGTATCTTGTATACTCGAGTATACAAGATACATTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-366s21c1
Sequence:CCGGCCTACGGCAATGAAGATGCTACTCGAGTAGCATCTTCATTGCCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-543s21c1
Sequence:CCGGTGTCAATCTACACTCATCATTCTCGAGAATGATGAGTGTAGATTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-457s21c1
Sequence:CCGGCCAGCTCTTCACTATGGAGAACTCGAGTTCTCCATAGTGAAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-1580s1c1
Sequence:CCGGGCACTCAATGTATCTTGTATACTCGAGTATACAAGATACATTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010128.3-366s1c1
Sequence:CCGGCCTACGGCAATGAAGATGCTACTCGAGTAGCATCTTCATTGCCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-543s1c1
Sequence:CCGGTGTCAATCTACACTCATCATTCTCGAGAATGATGAGTGTAGATTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-542s1c1
Sequence:CCGGGTGTCAATCTACACTCATCATCTCGAGATGATGAGTGTAGATTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010128.3-457s1c1
Sequence:CCGGCCAGCTCTTCACTATGGAGAACTCGAGTTCTCCATAGTGAAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010128
VALIDATED
EMP1 MISSION shRNA Lentiviral Transduction Particles
epithelial membrane protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010128.4-1577s21c1
Sequence:CCGGGCACTCAATGTATCTTGTATACTCGAGTATACAAGATACATTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-366s21c1
Sequence:CCGGCCTACGGCAATGAAGATGCTACTCGAGTAGCATCTTCATTGCCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-543s21c1
Sequence:CCGGTGTCAATCTACACTCATCATTCTCGAGAATGATGAGTGTAGATTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010128.4-457s21c1
Sequence:CCGGCCAGCTCTTCACTATGGAGAACTCGAGTTCTCCATAGTGAAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-1580s1c1
Sequence:CCGGGCACTCAATGTATCTTGTATACTCGAGTATACAAGATACATTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010128.3-366s1c1
Sequence:CCGGCCTACGGCAATGAAGATGCTACTCGAGTAGCATCTTCATTGCCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-543s1c1
Sequence:CCGGTGTCAATCTACACTCATCATTCTCGAGAATGATGAGTGTAGATTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010128.3-542s1c1
Sequence:CCGGGTGTCAATCTACACTCATCATCTCGAGATGATGAGTGTAGATTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010128.3-457s1c1
Sequence:CCGGCCAGCTCTTCACTATGGAGAACTCGAGTTCTCCATAGTGAAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)