EMAIL THIS PAGE TO A FRIEND

EMP2

epithelial membrane protein 2

Synonyms: XMP
UniProtKB ID: P54851, B2R7V6, D3DUF8
Gene ID:
Mouse(13731) epithelial membrane protein 2
Rat(360468) epithelial membrane protein 2
domestic guinea pig(100727813) epithelial membrane protein 2
naked mole-rat(101717736) epithelial membrane protein 2
sheep(101107656) epithelial membrane protein 2
Zebrafish(445506) epithelial membrane protein 2
cow(507667) epithelial membrane protein 2
domestic cat(101085593) epithelial membrane protein 2
dog(490010) epithelial membrane protein 2
chicken(416636) epithelial membrane protein 2
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001424 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061681 MISSION® esiRNA esiRNA targeting mouse Emp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001424 Rosetta Predictions human pricing
NM_001007721 Rosetta Predictions rat pricing
NM_007929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222132 predicted 568
2 SASI_Hs01_00222133 predicted 1102
3 SASI_Hs01_00222134 predicted 271
4 SASI_Hs01_00222136 predicted 1110
5 SASI_Hs01_00222138 predicted 327
6 SASI_Hs01_00222139 predicted 416
7 SASI_Hs01_00222140 predicted 1172
8 SASI_Hs01_00222141 predicted 1070
9 SASI_Hs02_00331828 predicted 325
10 SASI_Hs02_00331829 predicted 519
11 SASI_Hs01_00222135 predicted 483
12 SASI_Hs01_00222137 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071608 predicted 1080
2 SASI_Rn02_00198902 predicted 1127
3 SASI_Rn01_00071609 predicted 1098
4 SASI_Rn01_00071610 predicted 208
5 SASI_Rn01_00071611 predicted 1093
6 SASI_Rn01_00071614 predicted 449
7 SASI_Rn01_00071615 predicted 1032
8 SASI_Rn01_00071616 predicted 197
9 SASI_Rn02_00198903 predicted 233
10 SASI_Rn02_00198904 predicted 319
11 SASI_Rn01_00071612 predicted 485
12 SASI_Rn01_00071613 predicted 252
13 SASI_Rn01_00071617 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063713 predicted 409
2 SASI_Mm01_00063714 predicted 616
3 SASI_Mm01_00063715 predicted 409
4 SASI_Mm01_00063716 predicted 556
5 SASI_Mm01_00063717 predicted 411
6 SASI_Mm01_00063718 predicted 529
7 SASI_Mm01_00063719 predicted 404
8 SASI_Mm02_00312764 predicted 1253
9 SASI_Mm02_00312765 predicted 1258
10 SASI_Mm01_00063722 predicted 545
11 SASI_Mm01_00063720 predicted 250
12 SASI_Mm01_00063721 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007929
VALIDATED
EMP2 MISSION shRNA Bacterial Glycerol Stock
epithelial membrane protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-2132s1c1
Sequence:CCGGGCCTACTTTCTCTGTGTTCTTCTCGAGAAGAACACAGAGAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-413s1c1
Sequence:CCGGCCTGAAGCGTTTGAAGGTTATCTCGAGATAACCTTCAAACGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-592s1c1
Sequence:CCGGCGGAGCTTCCATCTATACAGACTCGAGTCTGTATAGATGGAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-421s1c1
Sequence:CCGGGTTTGAAGGTTATTCTGTGATCTCGAGATCACAGAATAACCTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-647s1c1
Sequence:CCGGCTCTATTACCTACTGCAAGAACTCGAGTTCTTGCAGTAGGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007929.2-2128s21c1
Sequence:CCGGGCCTACTTTCTCTGTGTTCTTCTCGAGAAGAACACAGAGAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-590s21c1
Sequence:CCGGCGGAGCTTCCATCTATACAGACTCGAGTCTGTATAGATGGAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-411s21c1
Sequence:CCGGCCTGAAGCGTTTGAAGGTTATCTCGAGATAACCTTCAAACGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-645s21c1
Sequence:CCGGCTCTATTACCTACTGCAAGAACTCGAGTTCTTGCAGTAGGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007929
VALIDATED
EMP2 MISSION shRNA shRNA Plasmid DNA
epithelial membrane protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-2132s1c1
Sequence:CCGGGCCTACTTTCTCTGTGTTCTTCTCGAGAAGAACACAGAGAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-413s1c1
Sequence:CCGGCCTGAAGCGTTTGAAGGTTATCTCGAGATAACCTTCAAACGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-592s1c1
Sequence:CCGGCGGAGCTTCCATCTATACAGACTCGAGTCTGTATAGATGGAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-421s1c1
Sequence:CCGGGTTTGAAGGTTATTCTGTGATCTCGAGATCACAGAATAACCTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-647s1c1
Sequence:CCGGCTCTATTACCTACTGCAAGAACTCGAGTTCTTGCAGTAGGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007929.2-2128s21c1
Sequence:CCGGGCCTACTTTCTCTGTGTTCTTCTCGAGAAGAACACAGAGAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-590s21c1
Sequence:CCGGCGGAGCTTCCATCTATACAGACTCGAGTCTGTATAGATGGAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-411s21c1
Sequence:CCGGCCTGAAGCGTTTGAAGGTTATCTCGAGATAACCTTCAAACGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-645s21c1
Sequence:CCGGCTCTATTACCTACTGCAAGAACTCGAGTTCTTGCAGTAGGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007929
VALIDATED
EMP2 MISSION shRNA Lentiviral Transduction Particles
epithelial membrane protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-2132s1c1
Sequence:CCGGGCCTACTTTCTCTGTGTTCTTCTCGAGAAGAACACAGAGAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-413s1c1
Sequence:CCGGCCTGAAGCGTTTGAAGGTTATCTCGAGATAACCTTCAAACGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-592s1c1
Sequence:CCGGCGGAGCTTCCATCTATACAGACTCGAGTCTGTATAGATGGAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-421s1c1
Sequence:CCGGGTTTGAAGGTTATTCTGTGATCTCGAGATCACAGAATAACCTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007929.1-647s1c1
Sequence:CCGGCTCTATTACCTACTGCAAGAACTCGAGTTCTTGCAGTAGGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007929.2-2128s21c1
Sequence:CCGGGCCTACTTTCTCTGTGTTCTTCTCGAGAAGAACACAGAGAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-590s21c1
Sequence:CCGGCGGAGCTTCCATCTATACAGACTCGAGTCTGTATAGATGGAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-411s21c1
Sequence:CCGGCCTGAAGCGTTTGAAGGTTATCTCGAGATAACCTTCAAACGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007929.2-645s21c1
Sequence:CCGGCTCTATTACCTACTGCAAGAACTCGAGTTCTTGCAGTAGGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001424
VALIDATED
EMP2 MISSION shRNA Bacterial Glycerol Stock
epithelial membrane protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001424.3-790s1c1
Sequence:CCGGGCAAACGTATTGTTTCCTTTACTCGAGTAAAGGAAACAATACGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-326s1c1
Sequence:CCGGCAACACGAATTGCACAGTCATCTCGAGATGACTGTGCAATTCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001424.3-329s1c1
Sequence:CCGGCACGAATTGCACAGTCATCAACTCGAGTTGATGACTGTGCAATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-551s1c1
Sequence:CCGGGCGTGAAGACATTCACGACAACTCGAGTTGTCGTGAATGTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-476s1c1
Sequence:CCGGGTTTGTCCTAACCTCCATCATCTCGAGATGATGGAGGTTAGGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001424.4-486s21c1
Sequence:CCGGACCTCCATCATCCAGCTAATGCTCGAGCATTAGCTGGATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001424.4-544s21c1
Sequence:CCGGCAGACAGGCGTGAAGACATTCCTCGAGGAATGTCTTCACGCCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001424.4-906s21c1
Sequence:CCGGAGACTATGAAGGCTGGTATTCCTCGAGGAATACCAGCCTTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001424.4-331s21c1
Sequence:CCGGCGAATTGCACAGTCATCAATGCTCGAGCATTGATGACTGTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001424.4-677s21c1
Sequence:CCGGGATACTGAGGAAGCGCAAATACTCGAGTATTTGCGCTTCCTCAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001424
VALIDATED
EMP2 MISSION shRNA shRNA Plasmid DNA
epithelial membrane protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001424.3-790s1c1
Sequence:CCGGGCAAACGTATTGTTTCCTTTACTCGAGTAAAGGAAACAATACGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-326s1c1
Sequence:CCGGCAACACGAATTGCACAGTCATCTCGAGATGACTGTGCAATTCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001424.3-329s1c1
Sequence:CCGGCACGAATTGCACAGTCATCAACTCGAGTTGATGACTGTGCAATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-551s1c1
Sequence:CCGGGCGTGAAGACATTCACGACAACTCGAGTTGTCGTGAATGTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-476s1c1
Sequence:CCGGGTTTGTCCTAACCTCCATCATCTCGAGATGATGGAGGTTAGGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001424.4-486s21c1
Sequence:CCGGACCTCCATCATCCAGCTAATGCTCGAGCATTAGCTGGATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001424.4-544s21c1
Sequence:CCGGCAGACAGGCGTGAAGACATTCCTCGAGGAATGTCTTCACGCCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001424.4-906s21c1
Sequence:CCGGAGACTATGAAGGCTGGTATTCCTCGAGGAATACCAGCCTTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001424.4-331s21c1
Sequence:CCGGCGAATTGCACAGTCATCAATGCTCGAGCATTGATGACTGTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001424.4-677s21c1
Sequence:CCGGGATACTGAGGAAGCGCAAATACTCGAGTATTTGCGCTTCCTCAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001424
VALIDATED
EMP2 MISSION shRNA Lentiviral Transduction Particles
epithelial membrane protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001424.3-790s1c1
Sequence:CCGGGCAAACGTATTGTTTCCTTTACTCGAGTAAAGGAAACAATACGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-326s1c1
Sequence:CCGGCAACACGAATTGCACAGTCATCTCGAGATGACTGTGCAATTCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001424.3-329s1c1
Sequence:CCGGCACGAATTGCACAGTCATCAACTCGAGTTGATGACTGTGCAATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-551s1c1
Sequence:CCGGGCGTGAAGACATTCACGACAACTCGAGTTGTCGTGAATGTCTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001424.3-476s1c1
Sequence:CCGGGTTTGTCCTAACCTCCATCATCTCGAGATGATGGAGGTTAGGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001424.4-486s21c1
Sequence:CCGGACCTCCATCATCCAGCTAATGCTCGAGCATTAGCTGGATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001424.4-544s21c1
Sequence:CCGGCAGACAGGCGTGAAGACATTCCTCGAGGAATGTCTTCACGCCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001424.4-906s21c1
Sequence:CCGGAGACTATGAAGGCTGGTATTCCTCGAGGAATACCAGCCTTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001424.4-331s21c1
Sequence:CCGGCGAATTGCACAGTCATCAATGCTCGAGCATTGATGACTGTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001424.4-677s21c1
Sequence:CCGGGATACTGAGGAAGCGCAAATACTCGAGTATTTGCGCTTCCTCAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks