EMAIL THIS PAGE TO A FRIEND

EMP3

epithelial membrane protein 3

50 Gene Product Result for
Synonyms: YMP
UniProtKB ID: P54852, Q6FH01
Gene ID:
Mouse(13732) epithelial membrane protein 3
Rat(81505) epithelial membrane protein 3
cow(535273) epithelial membrane protein 3
domestic cat(101088446) epithelial membrane protein 3
dog(484408) epithelial membrane protein 3
sheep(101121114) epithelial membrane protein 3
naked mole-rat(101698841) epithelial membrane protein 3
domestic guinea pig(100733864) epithelial membrane protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001425 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001425 Rosetta Predictions human pricing
NM_030847 Rosetta Predictions rat pricing
NM_010129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078542 predicted 414
2 SASI_Hs01_00078543 predicted 523
3 SASI_Hs01_00078544 predicted 518
4 SASI_Hs01_00078545 predicted 451
5 SASI_Hs01_00078546 predicted 439
6 SASI_Hs01_00078547 predicted 412
7 SASI_Hs01_00078548 predicted 521
8 SASI_Hs01_00078549 predicted 495
9 SASI_Hs01_00078551 predicted 466
10 SASI_Hs02_00331830 predicted 380
11 SASI_Hs01_00078550 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032571 predicted 297
2 SASI_Rn01_00032572 predicted 324
3 SASI_Rn01_00032573 predicted 304
4 SASI_Rn01_00032574 predicted 237
5 SASI_Rn01_00032575 predicted 428
6 SASI_Rn01_00032576 predicted 310
7 SASI_Rn01_00032577 predicted 195
8 SASI_Rn01_00032578 predicted 393
9 SASI_Rn01_00032579 predicted 473
10 SASI_Rn01_00032580 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160288 predicted 358
2 SASI_Mm01_00160289 predicted 301
3 SASI_Mm01_00160290 predicted 325
4 SASI_Mm01_00160291 predicted 305
5 SASI_Mm01_00160292 predicted 314
6 SASI_Mm01_00160293 predicted 397
7 SASI_Mm01_00160294 predicted 405
8 SASI_Mm01_00160295 predicted 317
9 SASI_Mm01_00160297 predicted 325
10 SASI_Mm02_00317851 predicted 374
11 SASI_Mm01_00160296 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010129
VALIDATED
EMP3 MISSION shRNA Bacterial Glycerol Stock
epithelial membrane protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-307s21c1
Sequence:CCGGGTGGACTCTCCCAGACAAAGACTCGAGTCTTTGTCTGGGAGAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-510s21c1
Sequence:CCGGTCTTCTACGCTACCGGCCTCTCTCGAGAGAGGCCGGTAGCGTAGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-318s21c1
Sequence:CCGGCAGACAAAGAGTCCCTGAACCCTCGAGGGTTCAGGGACTCTTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-541s21c1
Sequence:CCGGCACCAGTGCAGCTGTGTTCTCCTCGAGGAGAACACAGCTGCACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-371s21c1
Sequence:CCGGCAAACATGGGCCTGCAGTAACCTCGAGGTTACTGCAGGCCCATGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-447s1c1
Sequence:CCGGCCTCTTCATGTTCCAACTCTACTCGAGTAGAGTTGGAACATGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-361s1c1
Sequence:CCGGTGCAGTAACGTCAGTGAGAATCTCGAGATTCTCACTGACGTTACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010129.1-435s1c1
Sequence:CCGGCCTGTCCTTCATCCTCTTCATCTCGAGATGAAGAGGATGAAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-234s1c1
Sequence:CCGGCCACATCCTCATTCTTGTCTTCTCGAGAAGACAAGAATGAGGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010129.1-332s1c1
Sequence:CCGGCGTGGAACACCACCACTCAAACTCGAGTTTGAGTGGTGGTGTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010129
VALIDATED
EMP3 MISSION shRNA shRNA Plasmid DNA
epithelial membrane protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-307s21c1
Sequence:CCGGGTGGACTCTCCCAGACAAAGACTCGAGTCTTTGTCTGGGAGAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-510s21c1
Sequence:CCGGTCTTCTACGCTACCGGCCTCTCTCGAGAGAGGCCGGTAGCGTAGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-318s21c1
Sequence:CCGGCAGACAAAGAGTCCCTGAACCCTCGAGGGTTCAGGGACTCTTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-541s21c1
Sequence:CCGGCACCAGTGCAGCTGTGTTCTCCTCGAGGAGAACACAGCTGCACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-371s21c1
Sequence:CCGGCAAACATGGGCCTGCAGTAACCTCGAGGTTACTGCAGGCCCATGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-447s1c1
Sequence:CCGGCCTCTTCATGTTCCAACTCTACTCGAGTAGAGTTGGAACATGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-361s1c1
Sequence:CCGGTGCAGTAACGTCAGTGAGAATCTCGAGATTCTCACTGACGTTACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010129.1-435s1c1
Sequence:CCGGCCTGTCCTTCATCCTCTTCATCTCGAGATGAAGAGGATGAAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-234s1c1
Sequence:CCGGCCACATCCTCATTCTTGTCTTCTCGAGAAGACAAGAATGAGGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010129.1-332s1c1
Sequence:CCGGCGTGGAACACCACCACTCAAACTCGAGTTTGAGTGGTGGTGTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010129
VALIDATED
EMP3 MISSION shRNA Lentiviral Transduction Particles
epithelial membrane protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-307s21c1
Sequence:CCGGGTGGACTCTCCCAGACAAAGACTCGAGTCTTTGTCTGGGAGAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-510s21c1
Sequence:CCGGTCTTCTACGCTACCGGCCTCTCTCGAGAGAGGCCGGTAGCGTAGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-318s21c1
Sequence:CCGGCAGACAAAGAGTCCCTGAACCCTCGAGGGTTCAGGGACTCTTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-541s21c1
Sequence:CCGGCACCAGTGCAGCTGTGTTCTCCTCGAGGAGAACACAGCTGCACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010129.2-371s21c1
Sequence:CCGGCAAACATGGGCCTGCAGTAACCTCGAGGTTACTGCAGGCCCATGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-447s1c1
Sequence:CCGGCCTCTTCATGTTCCAACTCTACTCGAGTAGAGTTGGAACATGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-361s1c1
Sequence:CCGGTGCAGTAACGTCAGTGAGAATCTCGAGATTCTCACTGACGTTACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010129.1-435s1c1
Sequence:CCGGCCTGTCCTTCATCCTCTTCATCTCGAGATGAAGAGGATGAAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010129.1-234s1c1
Sequence:CCGGCCACATCCTCATTCTTGTCTTCTCGAGAAGACAAGAATGAGGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010129.1-332s1c1
Sequence:CCGGCGTGGAACACCACCACTCAAACTCGAGTTTGAGTGGTGGTGTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001425
VALIDATED
EMP3 MISSION shRNA Bacterial Glycerol Stock
epithelial membrane protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-284s21c1
Sequence:CCGGCCTTCACATCCTCATTCTTATCTCGAGATAAGAATGAGGATGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-596s21c1
Sequence:CCGGCGCCTTGATCTATGCCATTCACTCGAGTGAATGGCATAGATCAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-529s21c1
Sequence:CCGGGACGAGGAGGTCTCTTCTATGCTCGAGCATAGAAGAGACCTCCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-349s21c1
Sequence:CCGGCTGGGAAAGAGTCCCTGAATCCTCGAGGATTCAGGGACTCTTTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-460s21c1
Sequence:CCGGTCATGGTGCTCTCCCTCATTCCTCGAGGAATGAGGGAGAGCACCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-270s1c1
Sequence:CCGGCCCTTCACATCCTCATTCTTACTCGAGTAAGAATGAGGATGTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001425.1-371s1c1
Sequence:CCGGACGTGGAACAACGACACCAAACTCGAGTTTGGTGTCGTTGTTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-271s1c1
Sequence:CCGGCCTTCACATCCTCATTCTTATCTCGAGATAAGAATGAGGATGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-583s1c1
Sequence:CCGGCGCCTTGATCTATGCCATTCACTCGAGTGAATGGCATAGATCAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001425.1-401s1c1
Sequence:CCGGTGCAGTAATGTCAGCGAGAATCTCGAGATTCTCGCTGACATTACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001425
VALIDATED
EMP3 MISSION shRNA shRNA Plasmid DNA
epithelial membrane protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-284s21c1
Sequence:CCGGCCTTCACATCCTCATTCTTATCTCGAGATAAGAATGAGGATGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-596s21c1
Sequence:CCGGCGCCTTGATCTATGCCATTCACTCGAGTGAATGGCATAGATCAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-529s21c1
Sequence:CCGGGACGAGGAGGTCTCTTCTATGCTCGAGCATAGAAGAGACCTCCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-349s21c1
Sequence:CCGGCTGGGAAAGAGTCCCTGAATCCTCGAGGATTCAGGGACTCTTTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-460s21c1
Sequence:CCGGTCATGGTGCTCTCCCTCATTCCTCGAGGAATGAGGGAGAGCACCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-270s1c1
Sequence:CCGGCCCTTCACATCCTCATTCTTACTCGAGTAAGAATGAGGATGTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001425.1-371s1c1
Sequence:CCGGACGTGGAACAACGACACCAAACTCGAGTTTGGTGTCGTTGTTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-271s1c1
Sequence:CCGGCCTTCACATCCTCATTCTTATCTCGAGATAAGAATGAGGATGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-583s1c1
Sequence:CCGGCGCCTTGATCTATGCCATTCACTCGAGTGAATGGCATAGATCAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001425.1-401s1c1
Sequence:CCGGTGCAGTAATGTCAGCGAGAATCTCGAGATTCTCGCTGACATTACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001425
VALIDATED
EMP3 MISSION shRNA Lentiviral Transduction Particles
epithelial membrane protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-284s21c1
Sequence:CCGGCCTTCACATCCTCATTCTTATCTCGAGATAAGAATGAGGATGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-596s21c1
Sequence:CCGGCGCCTTGATCTATGCCATTCACTCGAGTGAATGGCATAGATCAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-529s21c1
Sequence:CCGGGACGAGGAGGTCTCTTCTATGCTCGAGCATAGAAGAGACCTCCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-349s21c1
Sequence:CCGGCTGGGAAAGAGTCCCTGAATCCTCGAGGATTCAGGGACTCTTTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001425.2-460s21c1
Sequence:CCGGTCATGGTGCTCTCCCTCATTCCTCGAGGAATGAGGGAGAGCACCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-270s1c1
Sequence:CCGGCCCTTCACATCCTCATTCTTACTCGAGTAAGAATGAGGATGTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001425.1-371s1c1
Sequence:CCGGACGTGGAACAACGACACCAAACTCGAGTTTGGTGTCGTTGTTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-271s1c1
Sequence:CCGGCCTTCACATCCTCATTCTTATCTCGAGATAAGAATGAGGATGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001425.1-583s1c1
Sequence:CCGGCGCCTTGATCTATGCCATTCACTCGAGTGAATGGCATAGATCAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001425.1-401s1c1
Sequence:CCGGTGCAGTAATGTCAGCGAGAATCTCGAGATTCTCGCTGACATTACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)