EMAIL THIS PAGE TO A FRIEND

EMR1

egf-like module containing, mucin-like, hormone receptor-like 1

79 Gene Product Result for
Synonyms: TM7LN3
Gene ID:
Human(2015) Summary: This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(13733) EGF-like module containing, mucin-like, hormone receptor-like sequence 1
Rat(316137) EGF-like module containing, mucin-like, hormone receptor-like 1
cow(508459) egf-like module containing, mucin-like, hormone receptor-like 1
dog(485015) egf-like module containing, mucin-like, hormone receptor-like 1
domestic cat(100174782) egf-like module containing, mucin-like, hormone receptor-like 1
naked mole-rat(101701699) egf-like module containing, mucin-like, hormone receptor-like 1
sheep(101107096) egf-like module containing, mucin-like, hormone receptor-like 1
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001974 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABN158 Anti-F4/80 Antibody, clone 18G2.1 100 µg, Detect F4/80 using this Anti-F4/80 Antibody, clone 18G2.1 validated for use in Western Blotting. pricing
MABF152B Anti-F4/80 (mouse), APC, clone BM8.1 Antibody 25 μg, This rat monoclonal Anti-F4/80 Antibody (mouse), APC, clone BM8.1, Cat. No. MABF1523 is validated for use in Flow Cytometry, for the detection of F4/80. pricing
MABF152C Anti-F4/80 (mouse), clone BM8.1, biotin conjugate Antibody 25 μg, Anti-F4/80 (mouse), clone BM8.1, biotin conjugate Antibody detects level of F4/80 and has been published and validated for use in Flow Cytometry. pricing
MABF152D Anti-F4/80 (mouse), FITC, clone BM8.1 Antibody 25 μg, This rat monoclonal Anti-F4/80 Antibody (mouse), FITC, clone BM8.1, Cat. No. MABF1527 is validated for use in Flow Cytometry, for the detection of F4/80. pricing
MABF152E Anti-F4/80 (mouse), PE, clone BM8.1 Antibody 25 μg, This rat monoclonal Anti-F4/80 Antibody (mouse), PE, clone BM8.1, Cat. No. MABF1529 is validated for use in Flow Cytometry, for the detection of F4/80. pricing
MABF153A Anti-F4/80 (mouse), PerCP-Cy5.5, clone BM8.1 Antibody 25 μg, Anti-F4/80 (mouse), PerCP-Cy5.5, clone BM8.1 Antibody is an antibody against F4/80 for use in Flow Cytometry. pricing
MABF153B Anti-F4/80 (mouse), violetFluor™ 450, clone BM8.1 Antibody 25 μg, Anti-F4/80 (mouse), violetFluor™ 450, clone BM8.1 Antibody is an antibody against F4/80 for use in Flow Cytometry. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001974 Rosetta Predictions human pricing
NM_001007557 Rosetta Predictions rat pricing
XM_579174 Rosetta Predictions rat pricing
NM_010130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332945 predicted 1725
2 SASI_Hs01_00172637 predicted 394
3 SASI_Hs01_00172638 predicted 586
4 SASI_Hs01_00172639 predicted 821
5 SASI_Hs01_00172640 predicted 2729
6 SASI_Hs01_00172641 predicted 1008
7 SASI_Hs01_00172642 predicted 1834
8 SASI_Hs01_00172643 predicted 1155
9 SASI_Hs02_00332946 predicted 1205
10 SASI_Hs01_00172644 predicted 785
11 SASI_Hs01_00172636 predicted 610
12 SASI_Hs01_00172645 predicted 2121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030523 predicted 819
2 SASI_Rn02_00198663 predicted 1508
3 SASI_Rn01_00030524 predicted 2878
4 SASI_Rn01_00030525 predicted 571
5 SASI_Rn01_00030527 predicted 538
6 SASI_Rn01_00030528 predicted 1688
7 SASI_Rn01_00030530 predicted 501
8 SASI_Rn01_00030531 predicted 2631
9 SASI_Rn01_00030532 predicted 444
10 SASI_Rn02_00198664 predicted 614
11 SASI_Rn01_00030526 predicted 2808
12 SASI_Rn01_00030529 predicted 2435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122596 predicted 2574
2 SASI_Rn01_00122597 predicted 2044
3 SASI_Rn01_00122598 predicted 2762
4 SASI_Rn01_00122599 predicted 2687
5 SASI_Rn01_00122600 predicted 662
6 SASI_Rn01_00122601 predicted 2437
7 SASI_Rn01_00122602 predicted 2325
8 SASI_Rn01_00122603 predicted 2527
9 SASI_Rn01_00122604 predicted 573
10 SASI_Rn01_00122605 predicted 2333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043244 predicted 1011
2 SASI_Mm01_00043246 predicted 594
3 SASI_Mm01_00043247 predicted 2442
4 SASI_Mm01_00043248 predicted 814
5 SASI_Mm01_00043249 predicted 620
6 SASI_Mm01_00043250 predicted 704
7 SASI_Mm01_00043252 predicted 449
8 SASI_Mm01_00043253 predicted 318
9 SASI_Mm02_00317852 predicted 1152
10 SASI_Mm02_00317853 predicted 1697
11 SASI_Mm01_00043245 predicted 2929
12 SASI_Mm01_00043251 predicted 1467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010130
EMR1 MISSION shRNA Bacterial Glycerol Stock
egf-like module containing, mucin-like, hormone receptor-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-2177s1c1
Sequence:CCGGCGGGATTCCTACACTATCTTTCTCGAGAAAGATAGTGTAGGAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-1211s1c1
Sequence:CCGGGCAGGGATCTTGGTTATGCTTCTCGAGAAGCATAACCAAGATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-316s1c1
Sequence:CCGGCCTAACTCAGTCTGCACCAATCTCGAGATTGGTGCAGACTGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-1478s1c1
Sequence:CCGGCGGAGTACCTAGACATCGAAACTCGAGTTTCGATGTCTAGGTACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-632s1c1
Sequence:CCGGCGTGCAACTCAGGACTTGAATCTCGAGATTCAAGTCCTGAGTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010130
EMR1 MISSION shRNA shRNA Plasmid DNA
egf-like module containing, mucin-like, hormone receptor-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-2177s1c1
Sequence:CCGGCGGGATTCCTACACTATCTTTCTCGAGAAAGATAGTGTAGGAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-1211s1c1
Sequence:CCGGGCAGGGATCTTGGTTATGCTTCTCGAGAAGCATAACCAAGATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-316s1c1
Sequence:CCGGCCTAACTCAGTCTGCACCAATCTCGAGATTGGTGCAGACTGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-1478s1c1
Sequence:CCGGCGGAGTACCTAGACATCGAAACTCGAGTTTCGATGTCTAGGTACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-632s1c1
Sequence:CCGGCGTGCAACTCAGGACTTGAATCTCGAGATTCAAGTCCTGAGTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010130
EMR1 MISSION shRNA Lentiviral Transduction Particles
egf-like module containing, mucin-like, hormone receptor-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-2177s1c1
Sequence:CCGGCGGGATTCCTACACTATCTTTCTCGAGAAAGATAGTGTAGGAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-1211s1c1
Sequence:CCGGGCAGGGATCTTGGTTATGCTTCTCGAGAAGCATAACCAAGATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-316s1c1
Sequence:CCGGCCTAACTCAGTCTGCACCAATCTCGAGATTGGTGCAGACTGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-1478s1c1
Sequence:CCGGCGGAGTACCTAGACATCGAAACTCGAGTTTCGATGTCTAGGTACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010130.1-632s1c1
Sequence:CCGGCGTGCAACTCAGGACTTGAATCTCGAGATTCAAGTCCTGAGTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001974
EMR1 MISSION shRNA Bacterial Glycerol Stock
egf-like module containing, mucin-like, hormone receptor-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-358s1c1
Sequence:CCGGGCTGTTTAGATGGTTTCTCTTCTCGAGAAGAGAAACCATCTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-879s1c1
Sequence:CCGGCCTAATTCTATCTGCACCAATCTCGAGATTGGTGCAGATAGAATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-178s1c1
Sequence:CCGGGCACCAATACAGTGGACAGTTCTCGAGAACTGTCCACTGTATTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-1144s1c1
Sequence:CCGGCCGTAGTTTCTCTGAAGAATACTCGAGTATTCTTCAGAGAAACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001974.3-2870s1c1
Sequence:CCGGCTGATGAGAAATCAGGCGTTTCTCGAGAAACGCCTGATTTCTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-865s21c1
Sequence:CCGGCATCAACCTGTGGTCCTAATTCTCGAGAATTAGGACCACAGGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-2680s21c1
Sequence:CCGGCCGCTTCCAAGACGGGTTAAACTCGAGTTTAACCCGTCTTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-1010s21c1
Sequence:CCGGAGATGTGATACCCGATAATAACTCGAGTTATTATCGGGTATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-1850s21c1
Sequence:CCGGCATTAGCCATGTAGGCATTATCTCGAGATAATGCCTACATGGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001974
EMR1 MISSION shRNA shRNA Plasmid DNA
egf-like module containing, mucin-like, hormone receptor-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-358s1c1
Sequence:CCGGGCTGTTTAGATGGTTTCTCTTCTCGAGAAGAGAAACCATCTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-879s1c1
Sequence:CCGGCCTAATTCTATCTGCACCAATCTCGAGATTGGTGCAGATAGAATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-178s1c1
Sequence:CCGGGCACCAATACAGTGGACAGTTCTCGAGAACTGTCCACTGTATTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-1144s1c1
Sequence:CCGGCCGTAGTTTCTCTGAAGAATACTCGAGTATTCTTCAGAGAAACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001974.3-2870s1c1
Sequence:CCGGCTGATGAGAAATCAGGCGTTTCTCGAGAAACGCCTGATTTCTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-865s21c1
Sequence:CCGGCATCAACCTGTGGTCCTAATTCTCGAGAATTAGGACCACAGGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-2680s21c1
Sequence:CCGGCCGCTTCCAAGACGGGTTAAACTCGAGTTTAACCCGTCTTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-1010s21c1
Sequence:CCGGAGATGTGATACCCGATAATAACTCGAGTTATTATCGGGTATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-1850s21c1
Sequence:CCGGCATTAGCCATGTAGGCATTATCTCGAGATAATGCCTACATGGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001974
EMR1 MISSION shRNA Lentiviral Transduction Particles
egf-like module containing, mucin-like, hormone receptor-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-358s1c1
Sequence:CCGGGCTGTTTAGATGGTTTCTCTTCTCGAGAAGAGAAACCATCTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-879s1c1
Sequence:CCGGCCTAATTCTATCTGCACCAATCTCGAGATTGGTGCAGATAGAATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-178s1c1
Sequence:CCGGGCACCAATACAGTGGACAGTTCTCGAGAACTGTCCACTGTATTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001974.3-1144s1c1
Sequence:CCGGCCGTAGTTTCTCTGAAGAATACTCGAGTATTCTTCAGAGAAACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001974.3-2870s1c1
Sequence:CCGGCTGATGAGAAATCAGGCGTTTCTCGAGAAACGCCTGATTTCTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-865s21c1
Sequence:CCGGCATCAACCTGTGGTCCTAATTCTCGAGAATTAGGACCACAGGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-2680s21c1
Sequence:CCGGCCGCTTCCAAGACGGGTTAAACTCGAGTTTAACCCGTCTTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-1010s21c1
Sequence:CCGGAGATGTGATACCCGATAATAACTCGAGTTATTATCGGGTATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001974.3-1850s21c1
Sequence:CCGGCATTAGCCATGTAGGCATTATCTCGAGATAATGCCTACATGGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks