EMAIL THIS PAGE TO A FRIEND

EMR2

egf-like module containing, mucin-like, hormone receptor-like 2

Synonyms: CD312
Gene ID:
Human(30817) Summary: This gene encodes a member of the class B seven-span transmembrane (TM7) subfamily of G-protein coupled receptors. These proteins are characterized by an extended extracellular region with a variable number of N-terminal epidermal growth factor-like domains coupled to a TM7 domain via a mucin-like spacer domain. The encoded protein is expressed mainly in myeloid cells where it promotes cell-cell adhesion through interaction with chondroitin sulfate chains. This gene is situated in a cluster of related genes on chromosome 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
cow(787836) egf-like module containing, mucin-like, hormone receptor-like 2
domestic cat(101100284) egf-like module containing, mucin-like, hormone receptor-like 2
dog(610750) egf-like module containing, mucin-like, hormone receptor-like 2
dog(484898) egf-like module containing, mucin-like, hormone receptor-like 2
355 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1431 Human EMR2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081031 MISSION® esiRNA esiRNA human EMR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013447 siRNAs that have been validated in the lab human pricing
NM_152916 Rosetta Predictions human pricing
NM_152917 Rosetta Predictions human pricing
NM_152918 Rosetta Predictions human pricing
NM_152919 Rosetta Predictions human pricing
NM_152920 Rosetta Predictions human pricing
NM_152921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013447 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134468 validated 2218
1 SASI_Hs01_00134467 validated 3005
2 SASI_Hs01_00134472 predicted 2821
3 SASI_Hs01_00134473 predicted 2540
4 SASI_Hs01_00134474 predicted 2634
5 SASI_Hs02_00344853 predicted 2828
6 SASI_Hs02_00344854 predicted 2647
7 SASI_Hs02_00344855 predicted 2819
8 SASI_Hs01_00134469 predicted 2259
9 SASI_Hs02_00344856 predicted 1916
10 SASI_Hs01_00134466 predicted 1956
11 SASI_Hs01_00134470 predicted 2260
12 SASI_Hs01_00134471 predicted 2364
13 SASI_Hs01_00134475 predicted 3014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155665 predicted 2669
2 SASI_Hs01_00155666 predicted 2389
3 SASI_Hs01_00155667 predicted 2479
4 SASI_Hs01_00155660 predicted 2854
5 SASI_Hs02_00366896 predicted 2684
6 SASI_Hs02_00366897 predicted 2499
7 SASI_Hs01_00155661 predicted 2063
8 SASI_Hs02_00366898 predicted 2674
9 SASI_Hs01_00155662 predicted 2115
10 SASI_Hs02_00366899 predicted 1772
11 SASI_Hs01_00155659 predicted 1807
12 SASI_Hs01_00155663 predicted 2113
13 SASI_Hs01_00155664 predicted 2223
14 SASI_Hs01_00155668 predicted 2864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108474 predicted 2537
2 SASI_Hs01_00108475 predicted 2262
3 SASI_Hs01_00108476 predicted 2351
4 SASI_Hs01_00108469 predicted 2724
5 SASI_Hs02_00366900 predicted 2544
6 SASI_Hs02_00366901 predicted 2364
7 SASI_Hs01_00108470 predicted 1939
8 SASI_Hs02_00366902 predicted 2540
9 SASI_Hs01_00108471 predicted 1981
10 SASI_Hs02_00366903 predicted 1637
11 SASI_Hs01_00108468 predicted 1675
12 SASI_Hs01_00108472 predicted 1981
13 SASI_Hs01_00108473 predicted 2084
14 SASI_Hs01_00108477 predicted 2738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133736 predicted 2388
2 SASI_Hs01_00133737 predicted 2116
3 SASI_Hs01_00133738 predicted 2204
4 SASI_Hs01_00133731 predicted 2578
5 SASI_Hs02_00366904 predicted 2400
6 SASI_Hs02_00366905 predicted 2221
7 SASI_Hs01_00133732 predicted 1789
8 SASI_Hs02_00366906 predicted 2395
9 SASI_Hs01_00133733 predicted 1840
10 SASI_Hs02_00366907 predicted 1493
11 SASI_Hs01_00133730 predicted 1537
12 SASI_Hs01_00133734 predicted 1830
13 SASI_Hs01_00133735 predicted 1938
14 SASI_Hs01_00133739 predicted 2581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106088 predicted 2789
2 SASI_Hs01_00106089 predicted 2509
3 SASI_Hs01_00106090 predicted 2597
4 SASI_Hs01_00106083 predicted 2967
5 SASI_Hs02_00366908 predicted 2789
6 SASI_Hs02_00366909 predicted 2612
7 SASI_Hs01_00106084 predicted 2182
8 SASI_Hs02_00366910 predicted 2790
9 SASI_Hs01_00106085 predicted 2228
10 SASI_Hs02_00366911 predicted 1880
11 SASI_Hs01_00106082 predicted 1930
12 SASI_Hs01_00106086 predicted 2220
13 SASI_Hs01_00106087 predicted 2335
14 SASI_Hs01_00106091 predicted 2981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014199 predicted 2643
2 SASI_Hs01_00014200 predicted 2362
3 SASI_Hs01_00014201 predicted 2454
4 SASI_Hs01_00014194 predicted 2826
5 SASI_Hs02_00366912 predicted 2642
6 SASI_Hs02_00366913 predicted 2461
7 SASI_Hs01_00014195 predicted 2035
8 SASI_Hs02_00366914 predicted 2640
9 SASI_Hs01_00014196 predicted 2078
10 SASI_Hs02_00366915 predicted 1739
11 SASI_Hs01_00014193 predicted 1780
12 SASI_Hs01_00014197 predicted 2076
13 SASI_Hs01_00014198 predicted 2187
14 SASI_Hs01_00014202 predicted 2829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164570 predicted 2504
2 SASI_Hs01_00164571 predicted 2226
3 SASI_Hs01_00164572 predicted 2316
4 SASI_Hs01_00164565 predicted 2692
5 SASI_Hs02_00366916 predicted 2515
6 SASI_Hs02_00366917 predicted 2326
7 SASI_Hs01_00164566 predicted 1900
8 SASI_Hs02_00366918 predicted 2507
9 SASI_Hs01_00164567 predicted 1950
10 SASI_Hs02_00366919 predicted 1600
11 SASI_Hs01_00164564 predicted 1641
12 SASI_Hs01_00164568 predicted 1945
13 SASI_Hs01_00164569 predicted 2055
14 SASI_Hs01_00164573 predicted 2704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013447
VALIDATED
EMR2 MISSION shRNA Bacterial Glycerol Stock
egf-like module containing, mucin-like, hormone receptor-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-1507s21c1
Sequence:CCGGGGGCTGTTGAACTTCAGTTATCTCGAGATAACTGAAGTTCAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-1332s21c1
Sequence:CCGGCAAGCCAGGCTTGGCCAATAACTCGAGTTATTGGCCAAGCCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2592s21c1
Sequence:CCGGCAGACTCTCCTCCCTCAATAGCTCGAGCTATTGAGGGAGGAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2905s21c1
Sequence:CCGGTCCAAACCCAGCACGGTTAACCTCGAGGTTAACCGTGCTGGGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2214s21c1
Sequence:CCGGCCTCGTGGCAATTGATCAAACCTCGAGGTTTGATCAATTGCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-3393s1c1
Sequence:CCGGCGGGTTTGATTATTTAGTCATCTCGAGATGACTAAATAATCAAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-2535s1c1
Sequence:CCGGCGCCATCTTCTCTGTGAATTTCTCGAGAAATTCACAGAGAAGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013447.2-2061s1c1
Sequence:CCGGGCTGACTGTCATCACCTACATCTCGAGATGTAGGTGATGACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-1485s1c1
Sequence:CCGGCCTGAGCAAGAACCTTTCCAACTCGAGTTGGAAAGGTTCTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-803s1c1
Sequence:CCGGCGTGTCAAGATGTGGACGAATCTCGAGATTCGTCCACATCTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013447
VALIDATED
EMR2 MISSION shRNA shRNA Plasmid DNA
egf-like module containing, mucin-like, hormone receptor-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-1507s21c1
Sequence:CCGGGGGCTGTTGAACTTCAGTTATCTCGAGATAACTGAAGTTCAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-1332s21c1
Sequence:CCGGCAAGCCAGGCTTGGCCAATAACTCGAGTTATTGGCCAAGCCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2592s21c1
Sequence:CCGGCAGACTCTCCTCCCTCAATAGCTCGAGCTATTGAGGGAGGAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2905s21c1
Sequence:CCGGTCCAAACCCAGCACGGTTAACCTCGAGGTTAACCGTGCTGGGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2214s21c1
Sequence:CCGGCCTCGTGGCAATTGATCAAACCTCGAGGTTTGATCAATTGCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-3393s1c1
Sequence:CCGGCGGGTTTGATTATTTAGTCATCTCGAGATGACTAAATAATCAAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-2535s1c1
Sequence:CCGGCGCCATCTTCTCTGTGAATTTCTCGAGAAATTCACAGAGAAGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013447.2-2061s1c1
Sequence:CCGGGCTGACTGTCATCACCTACATCTCGAGATGTAGGTGATGACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-1485s1c1
Sequence:CCGGCCTGAGCAAGAACCTTTCCAACTCGAGTTGGAAAGGTTCTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-803s1c1
Sequence:CCGGCGTGTCAAGATGTGGACGAATCTCGAGATTCGTCCACATCTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013447
VALIDATED
EMR2 MISSION shRNA Lentiviral Transduction Particles
egf-like module containing, mucin-like, hormone receptor-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-1507s21c1
Sequence:CCGGGGGCTGTTGAACTTCAGTTATCTCGAGATAACTGAAGTTCAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-1332s21c1
Sequence:CCGGCAAGCCAGGCTTGGCCAATAACTCGAGTTATTGGCCAAGCCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2592s21c1
Sequence:CCGGCAGACTCTCCTCCCTCAATAGCTCGAGCTATTGAGGGAGGAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2905s21c1
Sequence:CCGGTCCAAACCCAGCACGGTTAACCTCGAGGTTAACCGTGCTGGGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013447.2-2214s21c1
Sequence:CCGGCCTCGTGGCAATTGATCAAACCTCGAGGTTTGATCAATTGCCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-3393s1c1
Sequence:CCGGCGGGTTTGATTATTTAGTCATCTCGAGATGACTAAATAATCAAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-2535s1c1
Sequence:CCGGCGCCATCTTCTCTGTGAATTTCTCGAGAAATTCACAGAGAAGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013447.2-2061s1c1
Sequence:CCGGGCTGACTGTCATCACCTACATCTCGAGATGTAGGTGATGACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-1485s1c1
Sequence:CCGGCCTGAGCAAGAACCTTTCCAACTCGAGTTGGAAAGGTTCTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_013447.2-803s1c1
Sequence:CCGGCGTGTCAAGATGTGGACGAATCTCGAGATTCGTCCACATCTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks