EMAIL THIS PAGE TO A FRIEND

EMR3

egf-like module containing, mucin-like, hormone receptor-like 3

UniProtKB ID: Q9BY15
Gene ID:
Human(84658) Summary: This gene encodes a member of the class B seven-span transmembrane (TM7) receptor family expressed predominantly by cells of the immune system. Family members are characterized by an extended extracellular region with a variable number of N-terminal epidermal growth factor (EGF)-like domains coupled to a TM7 domain via a mucin-like spacer domain. This gene is closely linked to the gene encoding egf-like molecule containing mucin-like hormone receptor 2 on chromosome 19. This protein may play a role in myeloid-myeloid interactions during immune and inflammatory responses. [provided by RefSeq, Jul 2008]
dog(484900) egf-like module containing, mucin-like, hormone receptor-like 3
Horse(100064825) egf-like module containing, mucin-like, hormone receptor-like 3
domestic cat(101098285) egf-like module containing, mucin-like, hormone receptor-like 3
cow(526347) egf-like module containing, mucin-like, hormone receptor-like 3
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032571 Rosetta Predictions human pricing
NM_152939 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221492 predicted 1527
2 SASI_Hs01_00221493 predicted 859
3 SASI_Hs01_00221494 predicted 2020
4 SASI_Hs02_00360085 predicted 1782
5 SASI_Hs02_00360086 predicted 631
6 SASI_Hs01_00221495 predicted 741
7 SASI_Hs02_00360087 predicted 576
8 SASI_Hs02_00360088 predicted 423
9 SASI_Hs01_00221496 predicted 1518
10 SASI_Hs02_00360089 predicted 447
11 SASI_Hs01_00221497 predicted 1778
12 SASI_Hs01_00221498 predicted 1777
13 SASI_Hs01_00221499 predicted 957
14 SASI_Hs01_00221500 predicted 322
15 SASI_Hs01_00221501 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222516 predicted 840
2 SASI_Hs01_00222517 predicted 902
3 SASI_Hs01_00222518 predicted 814
4 SASI_Hs01_00222519 predicted 861
5 SASI_Hs01_00222520 predicted 781
6 SASI_Hs01_00222521 predicted 1025
7 SASI_Hs01_00222522 predicted 987
8 SASI_Hs01_00222523 predicted 918
9 SASI_Hs01_00222524 predicted 330
10 SASI_Hs01_00222525 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032571
EMR3 MISSION shRNA Bacterial Glycerol Stock
egf-like module containing, mucin-like, hormone receptor-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032571.2-2224s1c1
Sequence:CCGGCATGGATCTCTTTGGCATTATCTCGAGATAATGCCAAAGAGATCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-1203s1c1
Sequence:CCGGCGTGAACAAGAGTCACACCATCTCGAGATGGTGTGACTCTTGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-386s1c1
Sequence:CCGGCTGGGCAGAAACTATTCACATCTCGAGATGTGAATAGTTTCTGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-870s1c1
Sequence:CCGGCCAAATGAACTCAATGGACATCTCGAGATGTCCATTGAGTTCATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-1731s1c1
Sequence:CCGGCCAGGGATTCATGTGGAGTTTCTCGAGAAACTCCACATGAATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-1981s21c1
Sequence:CCGGGTGGTTTAGAGAGATCGTAAACTCGAGTTTACGATCTCTCTAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-775s21c1
Sequence:CCGGATTCAACTTGAACGTCCAAATCTCGAGATTTGGACGTTCAAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-277s21c1
Sequence:CCGGCACCTGCAACCATGGATATACCTCGAGGTATATCCATGGTTGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-333s21c1
Sequence:CCGGTGGAGACATGTAACGACATTACTCGAGTAATGTCGTTACATGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032571
EMR3 MISSION shRNA shRNA Plasmid DNA
egf-like module containing, mucin-like, hormone receptor-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032571.2-2224s1c1
Sequence:CCGGCATGGATCTCTTTGGCATTATCTCGAGATAATGCCAAAGAGATCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-1203s1c1
Sequence:CCGGCGTGAACAAGAGTCACACCATCTCGAGATGGTGTGACTCTTGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-386s1c1
Sequence:CCGGCTGGGCAGAAACTATTCACATCTCGAGATGTGAATAGTTTCTGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-870s1c1
Sequence:CCGGCCAAATGAACTCAATGGACATCTCGAGATGTCCATTGAGTTCATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-1731s1c1
Sequence:CCGGCCAGGGATTCATGTGGAGTTTCTCGAGAAACTCCACATGAATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-1981s21c1
Sequence:CCGGGTGGTTTAGAGAGATCGTAAACTCGAGTTTACGATCTCTCTAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-775s21c1
Sequence:CCGGATTCAACTTGAACGTCCAAATCTCGAGATTTGGACGTTCAAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-277s21c1
Sequence:CCGGCACCTGCAACCATGGATATACCTCGAGGTATATCCATGGTTGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-333s21c1
Sequence:CCGGTGGAGACATGTAACGACATTACTCGAGTAATGTCGTTACATGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032571
EMR3 MISSION shRNA Lentiviral Transduction Particles
egf-like module containing, mucin-like, hormone receptor-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032571.2-2224s1c1
Sequence:CCGGCATGGATCTCTTTGGCATTATCTCGAGATAATGCCAAAGAGATCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-1203s1c1
Sequence:CCGGCGTGAACAAGAGTCACACCATCTCGAGATGGTGTGACTCTTGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-386s1c1
Sequence:CCGGCTGGGCAGAAACTATTCACATCTCGAGATGTGAATAGTTTCTGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-870s1c1
Sequence:CCGGCCAAATGAACTCAATGGACATCTCGAGATGTCCATTGAGTTCATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032571.2-1731s1c1
Sequence:CCGGCCAGGGATTCATGTGGAGTTTCTCGAGAAACTCCACATGAATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-1981s21c1
Sequence:CCGGGTGGTTTAGAGAGATCGTAAACTCGAGTTTACGATCTCTCTAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-775s21c1
Sequence:CCGGATTCAACTTGAACGTCCAAATCTCGAGATTTGGACGTTCAAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-277s21c1
Sequence:CCGGCACCTGCAACCATGGATATACCTCGAGGTATATCCATGGTTGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032571.3-333s21c1
Sequence:CCGGTGGAGACATGTAACGACATTACTCGAGTAATGTCGTTACATGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks