EMAIL THIS PAGE TO A FRIEND

EMR4P

egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene

27 Gene Product Result for
Synonyms: EMR4 FIRE GPR127 PGR16
Species: Human EMR4P(326342)
UniProtKB ID: Q86SQ3, Q86SP1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080498 Rosetta Predictions human pricing
XM_377506 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315425 predicted 392
2 SASI_Hs02_00315426 predicted 358
3 SASI_Hs02_00315427 predicted 321
4 SASI_Hs02_00315428 predicted 605
5 SASI_Hs02_00315429 predicted 431
6 SASI_Hs02_00315430 predicted 265
7 SASI_Hs02_00315431 predicted 636
8 SASI_Hs02_00315432 predicted 366
9 SASI_Hs02_00315433 predicted 632
10 SASI_Hs02_00315434 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_377506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287985 predicted 2283
2 SASI_Hs01_00287986 predicted 2280
3 SASI_Hs01_00287987 predicted 2283
4 SASI_Hs01_00287988 predicted 2279
5 SASI_Hs01_00287989 predicted 868
6 SASI_Hs01_00287990 predicted 1920
7 SASI_Hs01_00287991 predicted 977
8 SASI_Hs01_00287992 predicted 1774
9 SASI_Hs01_00287993 predicted 1664
10 SASI_Hs01_00287994 predicted 1889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377506
EMR4P MISSION shRNA Bacterial Glycerol Stock
egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-1013s1c1
Sequence:CCGGCCCAGAATTATGGAACATTTACTCGAGTAAATGTTCCATAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-533s1c1
Sequence:CCGGGCAACGGTTCTTACACCAAATCTCGAGATTTGGTGTAAGAACCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-380s1c1
Sequence:CCGGCGACACAGTCAAACGTGGATACTCGAGTATCCACGTTTGACTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-231s1c1
Sequence:CCGGGCTGGCAAAGTGCAAGTATAACTCGAGTTATACTTGCACTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-349s1c1
Sequence:CCGGCCGGATTGTTACGAGAACAATCTCGAGATTGTTCTCGTAACAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377506
EMR4P MISSION shRNA shRNA Plasmid DNA
egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-1013s1c1
Sequence:CCGGCCCAGAATTATGGAACATTTACTCGAGTAAATGTTCCATAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-533s1c1
Sequence:CCGGGCAACGGTTCTTACACCAAATCTCGAGATTTGGTGTAAGAACCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-380s1c1
Sequence:CCGGCGACACAGTCAAACGTGGATACTCGAGTATCCACGTTTGACTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-231s1c1
Sequence:CCGGGCTGGCAAAGTGCAAGTATAACTCGAGTTATACTTGCACTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-349s1c1
Sequence:CCGGCCGGATTGTTACGAGAACAATCTCGAGATTGTTCTCGTAACAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377506
EMR4P MISSION shRNA Lentiviral Transduction Particles
egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-1013s1c1
Sequence:CCGGCCCAGAATTATGGAACATTTACTCGAGTAAATGTTCCATAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-533s1c1
Sequence:CCGGGCAACGGTTCTTACACCAAATCTCGAGATTTGGTGTAAGAACCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-380s1c1
Sequence:CCGGCGACACAGTCAAACGTGGATACTCGAGTATCCACGTTTGACTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-231s1c1
Sequence:CCGGGCTGGCAAAGTGCAAGTATAACTCGAGTTATACTTGCACTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377506.1-349s1c1
Sequence:CCGGCCGGATTGTTACGAGAACAATCTCGAGATTGTTCTCGTAACAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks