EMAIL THIS PAGE TO A FRIEND

EMX1

empty spiracles homeobox 1

103 Gene Product Result for
UniProtKB ID: Q04741, Q0D2P0, Q53T30, Q86XB0
Gene ID:
Mouse(13796) empty spiracles homeobox 1
Rat(500235) empty spiracles homeobox 1
Zebrafish(378964) empty spiracles homeobox 1
cow(539333) empty spiracles homeobox 1
chicken(768977) empty spiracles homeobox 1
sheep(101103146) empty spiracles homeobox 1
domestic guinea pig(100719130) empty spiracles homeobox 1
naked mole-rat(101710810) empty spiracles homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004097 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040404 Rosetta Predictions human pricing
NM_004097 Rosetta Predictions human pricing
XM_001073769 Rosetta Predictions rat pricing
XM_575584 Rosetta Predictions rat pricing
NM_010131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226839 predicted 1639
2 SASI_Hs01_00226840 predicted 1181
3 SASI_Hs01_00226841 predicted 1271
4 SASI_Hs01_00226842 predicted 1741
5 SASI_Hs01_00226843 predicted 1675
6 SASI_Hs01_00226844 predicted 1257
7 SASI_Hs01_00226845 predicted 1437
8 SASI_Hs01_00226846 predicted 1036
9 SASI_Hs01_00226847 predicted 1996
10 SASI_Hs01_00226848 predicted 1955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197877 predicted 1601
2 SASI_Hs01_00197878 predicted 1138
3 SASI_Hs01_00197879 predicted 1238
4 SASI_Hs01_00197880 predicted 1703
5 SASI_Hs01_00197884 predicted 1002
6 SASI_Hs01_00197881 predicted 1635
7 SASI_Hs01_00197882 predicted 1220
8 SASI_Hs01_00197883 predicted 1394
9 SASI_Hs01_00197885 predicted 866
10 SASI_Hs01_00197886 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343854 predicted 753
2 SASI_Rn02_00343855 predicted 530
3 SASI_Rn02_00343856 predicted 801
4 SASI_Rn02_00343857 predicted 921
5 SASI_Rn02_00343858 predicted 925
6 SASI_Rn02_00343859 predicted 756
7 SASI_Rn02_00343860 predicted 666
8 SASI_Rn02_00343861 predicted 390
9 SASI_Rn02_00343862 predicted 756
10 SASI_Rn02_00343863 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403803 predicted 752
2 SASI_Rn02_00403804 predicted 530
3 SASI_Rn02_00403805 predicted 798
4 SASI_Rn02_00403806 predicted 926
5 SASI_Rn02_00403807 predicted 919
6 SASI_Rn02_00403808 predicted 765
7 SASI_Rn02_00403809 predicted 663
8 SASI_Rn02_00403810 predicted 388
9 SASI_Rn02_00403811 predicted 755
10 SASI_Rn02_00403812 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317854 predicted 924
2 SASI_Mm02_00317855 predicted 926
3 SASI_Mm01_00078575 predicted 532
4 SASI_Mm01_00078576 predicted 471
5 SASI_Mm01_00078577 predicted 800
6 SASI_Mm01_00078578 predicted 259
7 SASI_Mm01_00078579 predicted 675
8 SASI_Mm01_00078580 predicted 535
9 SASI_Mm01_00078581 predicted 674
10 SASI_Mm01_00078582 predicted 757
11 SASI_Mm01_00078583 predicted 700
12 SASI_Mm01_00078584 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004097
EMX1 MISSION shRNA Bacterial Glycerol Stock
empty spiracles homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004097.1-1397s1c1
Sequence:CCGGCCGCCATTGACAGAGGGACAACTCGAGTTGTCCCTCTGTCAATGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1230s1c1
Sequence:CCGGCGATGTCACCTCCAATGACTACTCGAGTAGTCATTGGAGGTGACATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1005s1c1
Sequence:CCGGCGCCTTCGAGAAGAACCACTACTCGAGTAGTGGTTCTTCTCGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1101s1c1
Sequence:CCGGGAACCGGAGGACAAAGTACAACTCGAGTTGTACTTTGTCCTCCGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1110s1c1
Sequence:CCGGGACAAAGTACAAACGGCAGAACTCGAGTTCTGCCGTTTGTACTTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004097.2-500s21c1
Sequence:CCGGGCGGCTTTACCATAGAGTCCTCTCGAGAGGACTCTATGGTAAAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004097.2-1606s21c1
Sequence:CCGGCCCTTCCCTATGGGAATAATACTCGAGTATTATTCCCATAGGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004097
EMX1 MISSION shRNA shRNA Plasmid DNA
empty spiracles homeobox 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004097.1-1397s1c1
Sequence:CCGGCCGCCATTGACAGAGGGACAACTCGAGTTGTCCCTCTGTCAATGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1230s1c1
Sequence:CCGGCGATGTCACCTCCAATGACTACTCGAGTAGTCATTGGAGGTGACATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1005s1c1
Sequence:CCGGCGCCTTCGAGAAGAACCACTACTCGAGTAGTGGTTCTTCTCGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1101s1c1
Sequence:CCGGGAACCGGAGGACAAAGTACAACTCGAGTTGTACTTTGTCCTCCGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1110s1c1
Sequence:CCGGGACAAAGTACAAACGGCAGAACTCGAGTTCTGCCGTTTGTACTTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004097.2-500s21c1
Sequence:CCGGGCGGCTTTACCATAGAGTCCTCTCGAGAGGACTCTATGGTAAAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004097.2-1606s21c1
Sequence:CCGGCCCTTCCCTATGGGAATAATACTCGAGTATTATTCCCATAGGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004097
EMX1 MISSION shRNA Lentiviral Transduction Particles
empty spiracles homeobox 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004097.1-1397s1c1
Sequence:CCGGCCGCCATTGACAGAGGGACAACTCGAGTTGTCCCTCTGTCAATGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1230s1c1
Sequence:CCGGCGATGTCACCTCCAATGACTACTCGAGTAGTCATTGGAGGTGACATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1005s1c1
Sequence:CCGGCGCCTTCGAGAAGAACCACTACTCGAGTAGTGGTTCTTCTCGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1101s1c1
Sequence:CCGGGAACCGGAGGACAAAGTACAACTCGAGTTGTACTTTGTCCTCCGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004097.1-1110s1c1
Sequence:CCGGGACAAAGTACAAACGGCAGAACTCGAGTTCTGCCGTTTGTACTTTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004097.2-500s21c1
Sequence:CCGGGCGGCTTTACCATAGAGTCCTCTCGAGAGGACTCTATGGTAAAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004097.2-1606s21c1
Sequence:CCGGCCCTTCCCTATGGGAATAATACTCGAGTATTATTCCCATAGGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010131
EMX1 MISSION shRNA Bacterial Glycerol Stock
empty spiracles homeobox 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-543s1c1
Sequence:CCGGCTTTGAGAAGAATCACTACGTCTCGAGACGTAGTGATTCTTCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-760s1c1
Sequence:CCGGGACATTGATGTCACCTCCAATCTCGAGATTGGAGGTGACATCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-762s1c1
Sequence:CCGGCATTGATGTCACCTCCAATGACTCGAGTCATTGGAGGTGACATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-535s1c1
Sequence:CCGGGAGCGAGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010131
EMX1 MISSION shRNA shRNA Plasmid DNA
empty spiracles homeobox 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-543s1c1
Sequence:CCGGCTTTGAGAAGAATCACTACGTCTCGAGACGTAGTGATTCTTCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-760s1c1
Sequence:CCGGGACATTGATGTCACCTCCAATCTCGAGATTGGAGGTGACATCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-762s1c1
Sequence:CCGGCATTGATGTCACCTCCAATGACTCGAGTCATTGGAGGTGACATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-535s1c1
Sequence:CCGGGAGCGAGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010131
EMX1 MISSION shRNA Lentiviral Transduction Particles
empty spiracles homeobox 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-543s1c1
Sequence:CCGGCTTTGAGAAGAATCACTACGTCTCGAGACGTAGTGATTCTTCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-760s1c1
Sequence:CCGGGACATTGATGTCACCTCCAATCTCGAGATTGGAGGTGACATCAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-762s1c1
Sequence:CCGGCATTGATGTCACCTCCAATGACTCGAGTCATTGGAGGTGACATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010131.1-535s1c1
Sequence:CCGGGAGCGAGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)