EMAIL THIS PAGE TO A FRIEND

EMX2

empty spiracles homeobox 2

113 Gene Product Result for
UniProtKB ID: Q04743, G3V305, Q96NN8, Q9BQF4
Gene ID:
Human(2018) Summary: This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]
Mouse(13797) empty spiracles homeobox 2
Rat(499380) empty spiracles homeobox 2
naked mole-rat(101724841) empty spiracles homeobox 2
domestic guinea pig(100718552) empty spiracles homeobox 2
sheep(101105042) empty spiracles homeobox 2
Zebrafish(30537) empty spiracles homeobox 2
cow(523601) empty spiracles homeobox 2
domestic cat(101087011) empty spiracles homeobox 2
dog(610697) empty spiracles homeobox 2
chicken(423923) empty spiracles homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E6780 Anti-Emx-2 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
SAB2108465 Anti-EMX2 affinity isolated antibody rat, rabbit, mouse, bovine, guinea pig, canine, pig, human, zebrafish
immunohistochemistry, western blot pricing
SAB1408975 Anti-EMX2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412022 ANTI-EMX2 antibody produced in mouse clone 4D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412023 ANTI-EMX2 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412024 ANTI-EMX2 antibody produced in mouse clone 3C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412025 ANTI-EMX2 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV31643 Anti-EMX2 antibody produced in rabbit affinity isolated antibody bovine, canine, zebrafish, mouse, rat, human, rabbit, guinea pig
immunohistochemistry, western blot pricing
HPA065294 Anti-EMX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500767 Anti-EMX2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB1410335 Anti-EMX2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
WH0002018M1 Monoclonal Anti-EMX2 antibody produced in mouse clone 3D5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403770 Monoclonal Anti-EMX2 antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004098 Rosetta Predictions human pricing
NM_001109169 Rosetta Predictions rat pricing
NM_010132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051378 predicted 1334
2 SASI_Hs01_00051379 predicted 1396
3 SASI_Hs01_00051380 predicted 1259
4 SASI_Hs01_00051381 predicted 1206
5 SASI_Hs01_00051382 predicted 1329
6 SASI_Hs01_00051383 predicted 1264
7 SASI_Hs01_00051385 predicted 1350
8 SASI_Hs01_00051386 predicted 1211
9 SASI_Hs01_00051387 predicted 1316
10 SASI_Hs02_00336909 predicted 1324
11 SASI_Hs01_00051384 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245800 predicted 1423
2 SASI_Rn02_00245801 predicted 1582
3 SASI_Rn02_00245802 predicted 1529
4 SASI_Rn02_00245803 predicted 1481
5 SASI_Rn02_00245804 predicted 1418
6 SASI_Rn02_00245805 predicted 1291
7 SASI_Rn02_00245806 predicted 2045
8 SASI_Rn02_00245807 predicted 1361
9 SASI_Rn02_00245808 predicted 2052
10 SASI_Rn02_00245809 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113246 predicted 1164
2 SASI_Mm01_00113247 predicted 1090
3 SASI_Mm01_00113248 predicted 1263
4 SASI_Mm01_00113249 predicted 1161
5 SASI_Mm01_00113250 predicted 1268
6 SASI_Mm02_00317856 predicted 1289
7 SASI_Mm01_00113251 predicted 636
8 SASI_Mm01_00113252 predicted 1479
9 SASI_Mm01_00113253 predicted 1710
10 SASI_Mm01_00113254 predicted 631
11 SASI_Mm01_00113245 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010132
EMX2 MISSION shRNA Bacterial Glycerol Stock
empty spiracles homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010132.2-896s21c1
Sequence:CCGGCTCATCCACCGCTACCGATATCTCGAGATATCGGTAGCGGTGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010132.2-1631s21c1
Sequence:CCGGTTGTGAGGCAAAGGCACATTCCTCGAGGAATGTGCCTTTGCCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010132.2-1528s21c1
Sequence:CCGGACATGCAACCCTCGTCTAAAGCTCGAGCTTTAGACGAGGGTTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010132.1-2385s1c1
Sequence:CCGGCCTTCTATTGTCAAAGTGATTCTCGAGAATCACTTTGACAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-1575s1c1
Sequence:CCGGCGGAGGAAATAGATGTGACCTCTCGAGAGGTCACATCTATTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-958s1c1
Sequence:CCGGCGCCAATTCCAGTCCCATAAACTCGAGTTTATGGGACTGGAATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-970s1c1
Sequence:CCGGTCCCATAAATCCGTTCCTCAACTCGAGTTGAGGAACGGATTTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-1456s1c1
Sequence:CCGGGAACCGGAGAACGAAATTCAACTCGAGTTGAATTTCGTTCTCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010132
EMX2 MISSION shRNA shRNA Plasmid DNA
empty spiracles homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010132.2-896s21c1
Sequence:CCGGCTCATCCACCGCTACCGATATCTCGAGATATCGGTAGCGGTGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010132.2-1631s21c1
Sequence:CCGGTTGTGAGGCAAAGGCACATTCCTCGAGGAATGTGCCTTTGCCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010132.2-1528s21c1
Sequence:CCGGACATGCAACCCTCGTCTAAAGCTCGAGCTTTAGACGAGGGTTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010132.1-2385s1c1
Sequence:CCGGCCTTCTATTGTCAAAGTGATTCTCGAGAATCACTTTGACAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-1575s1c1
Sequence:CCGGCGGAGGAAATAGATGTGACCTCTCGAGAGGTCACATCTATTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-958s1c1
Sequence:CCGGCGCCAATTCCAGTCCCATAAACTCGAGTTTATGGGACTGGAATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-970s1c1
Sequence:CCGGTCCCATAAATCCGTTCCTCAACTCGAGTTGAGGAACGGATTTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-1456s1c1
Sequence:CCGGGAACCGGAGAACGAAATTCAACTCGAGTTGAATTTCGTTCTCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010132
EMX2 MISSION shRNA Lentiviral Transduction Particles
empty spiracles homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010132.2-896s21c1
Sequence:CCGGCTCATCCACCGCTACCGATATCTCGAGATATCGGTAGCGGTGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010132.2-1631s21c1
Sequence:CCGGTTGTGAGGCAAAGGCACATTCCTCGAGGAATGTGCCTTTGCCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010132.2-1528s21c1
Sequence:CCGGACATGCAACCCTCGTCTAAAGCTCGAGCTTTAGACGAGGGTTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010132.1-2385s1c1
Sequence:CCGGCCTTCTATTGTCAAAGTGATTCTCGAGAATCACTTTGACAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-1575s1c1
Sequence:CCGGCGGAGGAAATAGATGTGACCTCTCGAGAGGTCACATCTATTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-958s1c1
Sequence:CCGGCGCCAATTCCAGTCCCATAAACTCGAGTTTATGGGACTGGAATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-970s1c1
Sequence:CCGGTCCCATAAATCCGTTCCTCAACTCGAGTTGAGGAACGGATTTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010132.1-1456s1c1
Sequence:CCGGGAACCGGAGAACGAAATTCAACTCGAGTTGAATTTCGTTCTCCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004098
VALIDATED
EMX2 MISSION shRNA Bacterial Glycerol Stock
empty spiracles homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004098.3-1464s21c1
Sequence:CCGGTGGAGGAAGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004098.3-2002s21c1
Sequence:CCGGCGTTTATCACAGTCCACTTAACTCGAGTTAAGTGGACTGTGATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1190s21c1
Sequence:CCGGCTCATCCACCGCTACCGATATCTCGAGATATCGGTAGCGGTGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1399s21c1
Sequence:CCGGCCTCACGGAAACTCAGGTAAACTCGAGTTTACCTGAGTTTCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1331s21c1
Sequence:CCGGGAACACGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004098.2-2163s1c1
Sequence:CCGGCCTGTTTCAAATCCTTGAAATCTCGAGATTTCAAGGATTTGAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1556s1c1
Sequence:CCGGGAAATAGACGTGACCTCAGATCTCGAGATCTGAGGTCACGTCTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004098.2-922s1c1
Sequence:CCGGCGCGGCACTCAGCTACGCTAACTCGAGTTAGCGTAGCTGAGTGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1464s1c1
Sequence:CCGGTGGAGGAAGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1331s1c1
Sequence:CCGGGAACACGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004098
VALIDATED
EMX2 MISSION shRNA shRNA Plasmid DNA
empty spiracles homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004098.3-1464s21c1
Sequence:CCGGTGGAGGAAGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004098.3-2002s21c1
Sequence:CCGGCGTTTATCACAGTCCACTTAACTCGAGTTAAGTGGACTGTGATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1190s21c1
Sequence:CCGGCTCATCCACCGCTACCGATATCTCGAGATATCGGTAGCGGTGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1399s21c1
Sequence:CCGGCCTCACGGAAACTCAGGTAAACTCGAGTTTACCTGAGTTTCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1331s21c1
Sequence:CCGGGAACACGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004098.2-2163s1c1
Sequence:CCGGCCTGTTTCAAATCCTTGAAATCTCGAGATTTCAAGGATTTGAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1556s1c1
Sequence:CCGGGAAATAGACGTGACCTCAGATCTCGAGATCTGAGGTCACGTCTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004098.2-922s1c1
Sequence:CCGGCGCGGCACTCAGCTACGCTAACTCGAGTTAGCGTAGCTGAGTGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1464s1c1
Sequence:CCGGTGGAGGAAGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1331s1c1
Sequence:CCGGGAACACGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004098
VALIDATED
EMX2 MISSION shRNA Lentiviral Transduction Particles
empty spiracles homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004098.3-1464s21c1
Sequence:CCGGTGGAGGAAGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004098.3-2002s21c1
Sequence:CCGGCGTTTATCACAGTCCACTTAACTCGAGTTAAGTGGACTGTGATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1190s21c1
Sequence:CCGGCTCATCCACCGCTACCGATATCTCGAGATATCGGTAGCGGTGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1399s21c1
Sequence:CCGGCCTCACGGAAACTCAGGTAAACTCGAGTTTACCTGAGTTTCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004098.3-1331s21c1
Sequence:CCGGGAACACGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004098.2-2163s1c1
Sequence:CCGGCCTGTTTCAAATCCTTGAAATCTCGAGATTTCAAGGATTTGAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1556s1c1
Sequence:CCGGGAAATAGACGTGACCTCAGATCTCGAGATCTGAGGTCACGTCTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004098.2-922s1c1
Sequence:CCGGCGCGGCACTCAGCTACGCTAACTCGAGTTAGCGTAGCTGAGTGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1464s1c1
Sequence:CCGGTGGAGGAAGAAGGCTCAGATTCTCGAGAATCTGAGCCTTCTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004098.2-1331s1c1
Sequence:CCGGGAACACGCCTTTGAGAAGAATCTCGAGATTCTTCTCAAAGGCGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks