EMAIL THIS PAGE TO A FRIEND

EN1

engrailed homeobox 1

90 Gene Product Result for
UniProtKB ID: Q05925, Q4ZG44
Gene ID:
Human(2019) Summary: Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(13798) engrailed 1
Rat(685360) engrailed homeobox 1
chicken(771008) engrailed homeobox 1
cow(280782) engrailed
dog(100685332) engrailed homeobox 1
domestic cat(101085909) engrailed homeobox 1
cow(529707) engrailed homeobox 1
domestic guinea pig(100716217) engrailed homeobox 1
naked mole-rat(101709192) engrailed homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001426 Rosetta Predictions human pricing
XM_001056699 Rosetta Predictions rat pricing
XM_001056772 Rosetta Predictions rat pricing
NM_010133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192294 predicted 1979
2 SASI_Hs01_00192295 predicted 1963
3 SASI_Hs01_00192296 predicted 1963
4 SASI_Hs01_00192297 predicted 1952
5 SASI_Hs01_00192298 predicted 1968
6 SASI_Hs01_00192299 predicted 1972
7 SASI_Hs01_00192300 predicted 1963
8 SASI_Hs01_00192301 predicted 1930
9 SASI_Hs01_00192302 predicted 1876
10 SASI_Hs01_00192303 predicted 1921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284122 predicted 1389
2 SASI_Rn02_00284123 predicted 1433
3 SASI_Rn02_00284124 predicted 1423
4 SASI_Rn02_00284125 predicted 1137
5 SASI_Rn02_00284126 predicted 1323
6 SASI_Rn02_00284127 predicted 1422
7 SASI_Rn02_00284128 predicted 1622
8 SASI_Rn02_00284129 predicted 1393
9 SASI_Rn02_00284130 predicted 1421
10 SASI_Rn02_00284131 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284386 predicted 1411
2 SASI_Rn02_00284387 predicted 1465
3 SASI_Rn02_00284388 predicted 1451
4 SASI_Rn02_00284389 predicted 1161
5 SASI_Rn02_00284390 predicted 1351
6 SASI_Rn02_00284391 predicted 1442
7 SASI_Rn02_00284392 predicted 1647
8 SASI_Rn02_00284393 predicted 1414
9 SASI_Rn02_00284394 predicted 1444
10 SASI_Rn02_00284395 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180197 predicted 1588
2 SASI_Mm01_00180199 predicted 1594
3 SASI_Mm01_00180203 predicted 1891
4 SASI_Mm02_00317857 predicted 1640
5 SASI_Mm01_00180205 predicted 1529
6 SASI_Mm02_00317858 predicted 1517
7 SASI_Mm01_00180206 predicted 1714
8 SASI_Mm02_00317859 predicted 1520
9 SASI_Mm02_00317860 predicted 1830
10 SASI_Mm02_00317861 predicted 1737
11 SASI_Mm01_00180198 predicted 839
12 SASI_Mm01_00180200 predicted 1335
13 SASI_Mm01_00180201 predicted 1125
14 SASI_Mm01_00180202 predicted 1348
15 SASI_Mm01_00180204 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001426
VALIDATED
EN1 MISSION shRNA Bacterial Glycerol Stock
engrailed homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001426.2-2415s1c1
Sequence:CCGGCCATTCTCTATTCCCAGTATACTCGAGTATACTGGGAATAGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-1753s1c1
Sequence:CCGGCAACCCGGCTATCCTACTTATCTCGAGATAAGTAGGATAGCCGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001426.2-1851s1c1
Sequence:CCGGCACGTTATTCGGATCGTCCATCTCGAGATGGACGATCCGAATAACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-2086s1c1
Sequence:CCGGGATCAAGAAAGCCACAGGCATCTCGAGATGCCTGTGGCTTTCTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-1339s1c1
Sequence:CCGGCAACATCCTGAGGCCGGACTTCTCGAGAAGTCCGGCCTCAGGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-1754s21c1
Sequence:CCGGCAACCCGGCTATCCTACTTATCTCGAGATAAGTAGGATAGCCGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001426.3-2349s21c1
Sequence:CCGGTGACGTTGAAACGCAGCATTTCTCGAGAAATGCTGCGTTTCAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-2087s21c1
Sequence:CCGGGATCAAGAAAGCCACAGGCATCTCGAGATGCCTGTGGCTTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001426.3-2044s21c1
Sequence:CCGGACGAGTCCCAGATCAAGATCTCTCGAGAGATCTTGATCTGGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-1979s21c1
Sequence:CCGGGTTCCAGGCAAACCGCTACATCTCGAGATGTAGCGGTTTGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001426
VALIDATED
EN1 MISSION shRNA shRNA Plasmid DNA
engrailed homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001426.2-2415s1c1
Sequence:CCGGCCATTCTCTATTCCCAGTATACTCGAGTATACTGGGAATAGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-1753s1c1
Sequence:CCGGCAACCCGGCTATCCTACTTATCTCGAGATAAGTAGGATAGCCGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001426.2-1851s1c1
Sequence:CCGGCACGTTATTCGGATCGTCCATCTCGAGATGGACGATCCGAATAACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-2086s1c1
Sequence:CCGGGATCAAGAAAGCCACAGGCATCTCGAGATGCCTGTGGCTTTCTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-1339s1c1
Sequence:CCGGCAACATCCTGAGGCCGGACTTCTCGAGAAGTCCGGCCTCAGGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-1754s21c1
Sequence:CCGGCAACCCGGCTATCCTACTTATCTCGAGATAAGTAGGATAGCCGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001426.3-2349s21c1
Sequence:CCGGTGACGTTGAAACGCAGCATTTCTCGAGAAATGCTGCGTTTCAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-2087s21c1
Sequence:CCGGGATCAAGAAAGCCACAGGCATCTCGAGATGCCTGTGGCTTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001426.3-2044s21c1
Sequence:CCGGACGAGTCCCAGATCAAGATCTCTCGAGAGATCTTGATCTGGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-1979s21c1
Sequence:CCGGGTTCCAGGCAAACCGCTACATCTCGAGATGTAGCGGTTTGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001426
VALIDATED
EN1 MISSION shRNA Lentiviral Transduction Particles
engrailed homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001426.2-2415s1c1
Sequence:CCGGCCATTCTCTATTCCCAGTATACTCGAGTATACTGGGAATAGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-1753s1c1
Sequence:CCGGCAACCCGGCTATCCTACTTATCTCGAGATAAGTAGGATAGCCGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001426.2-1851s1c1
Sequence:CCGGCACGTTATTCGGATCGTCCATCTCGAGATGGACGATCCGAATAACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-2086s1c1
Sequence:CCGGGATCAAGAAAGCCACAGGCATCTCGAGATGCCTGTGGCTTTCTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001426.2-1339s1c1
Sequence:CCGGCAACATCCTGAGGCCGGACTTCTCGAGAAGTCCGGCCTCAGGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-1754s21c1
Sequence:CCGGCAACCCGGCTATCCTACTTATCTCGAGATAAGTAGGATAGCCGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001426.3-2349s21c1
Sequence:CCGGTGACGTTGAAACGCAGCATTTCTCGAGAAATGCTGCGTTTCAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-2087s21c1
Sequence:CCGGGATCAAGAAAGCCACAGGCATCTCGAGATGCCTGTGGCTTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001426.3-2044s21c1
Sequence:CCGGACGAGTCCCAGATCAAGATCTCTCGAGAGATCTTGATCTGGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001426.3-1979s21c1
Sequence:CCGGGTTCCAGGCAAACCGCTACATCTCGAGATGTAGCGGTTTGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010133
EN1 MISSION shRNA Bacterial Glycerol Stock
engrailed homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010133.1-2169s1c1
Sequence:CCGGCCCTGCCTCTTCTCTATTTATCTCGAGATAAATAGAGAAGAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1342s1c1
Sequence:CCGGGTTCCAGGCAAACCGCTATATCTCGAGATATAGCGGTTTGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-686s1c1
Sequence:CCGGGATAACATCCTAAGGCCCGATCTCGAGATCGGGCCTTAGGATGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1324s1c1
Sequence:CCGGGCAGAGACTCAAGGCGGAGTTCTCGAGAACTCCGCCTTGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1163s1c1
Sequence:CCGGGTCAAGACTGACTCACAGCAACTCGAGTTGCTGTGAGTCAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010133.2-1437s21c1
Sequence:CCGGTCCACGCACCAGGAAGCTAAACTCGAGTTTAGCTTCCTGGTGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010133.2-1906s21c1
Sequence:CCGGTCCGAGTGGACATTCACATAGCTCGAGCTATGTGAATGTCCACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010133.2-1634s21c1
Sequence:CCGGAGCGTGCCAAGATCAAGAAAGCTCGAGCTTTCTTGATCTTGGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010133
EN1 MISSION shRNA shRNA Plasmid DNA
engrailed homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010133.1-2169s1c1
Sequence:CCGGCCCTGCCTCTTCTCTATTTATCTCGAGATAAATAGAGAAGAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1342s1c1
Sequence:CCGGGTTCCAGGCAAACCGCTATATCTCGAGATATAGCGGTTTGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-686s1c1
Sequence:CCGGGATAACATCCTAAGGCCCGATCTCGAGATCGGGCCTTAGGATGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1324s1c1
Sequence:CCGGGCAGAGACTCAAGGCGGAGTTCTCGAGAACTCCGCCTTGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1163s1c1
Sequence:CCGGGTCAAGACTGACTCACAGCAACTCGAGTTGCTGTGAGTCAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010133.2-1437s21c1
Sequence:CCGGTCCACGCACCAGGAAGCTAAACTCGAGTTTAGCTTCCTGGTGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010133.2-1906s21c1
Sequence:CCGGTCCGAGTGGACATTCACATAGCTCGAGCTATGTGAATGTCCACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010133.2-1634s21c1
Sequence:CCGGAGCGTGCCAAGATCAAGAAAGCTCGAGCTTTCTTGATCTTGGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010133
EN1 MISSION shRNA Lentiviral Transduction Particles
engrailed homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010133.1-2169s1c1
Sequence:CCGGCCCTGCCTCTTCTCTATTTATCTCGAGATAAATAGAGAAGAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1342s1c1
Sequence:CCGGGTTCCAGGCAAACCGCTATATCTCGAGATATAGCGGTTTGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-686s1c1
Sequence:CCGGGATAACATCCTAAGGCCCGATCTCGAGATCGGGCCTTAGGATGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1324s1c1
Sequence:CCGGGCAGAGACTCAAGGCGGAGTTCTCGAGAACTCCGCCTTGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010133.1-1163s1c1
Sequence:CCGGGTCAAGACTGACTCACAGCAACTCGAGTTGCTGTGAGTCAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010133.2-1437s21c1
Sequence:CCGGTCCACGCACCAGGAAGCTAAACTCGAGTTTAGCTTCCTGGTGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010133.2-1906s21c1
Sequence:CCGGTCCGAGTGGACATTCACATAGCTCGAGCTATGTGAATGTCCACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010133.2-1634s21c1
Sequence:CCGGAGCGTGCCAAGATCAAGAAAGCTCGAGCTTTCTTGATCTTGGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks