EMAIL THIS PAGE TO A FRIEND

EN2

engrailed homeobox 2

113 Gene Product Result for
UniProtKB ID: P19622, A4D252, Q549U3, Q9UD58
Gene ID:
Human(2020) Summary: Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(13799) engrailed 2
Rat(499964) engrailed homeobox 2
naked mole-rat(101721665) engrailed homeobox 2
domestic guinea pig(100728143) engrailed homeobox 2
sheep(101117159) engrailed homeobox 2
cow(280783) engrailed homeobox 2
domestic cat(101087911) engrailed homeobox 2
dog(611369) engrailed homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001427 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001427 Rosetta Predictions human pricing
NM_001109214 Rosetta Predictions rat pricing
NM_010134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149634 predicted 1014
2 SASI_Hs01_00149635 predicted 887
3 SASI_Hs01_00149636 predicted 943
4 SASI_Hs01_00149637 predicted 1033
5 SASI_Hs01_00149638 predicted 992
6 SASI_Hs01_00149640 predicted 1026
7 SASI_Hs01_00149641 predicted 907
8 SASI_Hs01_00149642 predicted 1216
9 SASI_Hs01_00149639 predicted 1096
10 SASI_Hs01_00149643 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246210 predicted 789
2 SASI_Rn02_00246211 predicted 256
3 SASI_Rn02_00246212 predicted 721
4 SASI_Rn02_00246213 predicted 479
5 SASI_Rn02_00246214 predicted 488
6 SASI_Rn02_00246215 predicted 585
7 SASI_Rn02_00246216 predicted 713
8 SASI_Rn02_00246217 predicted 215
9 SASI_Rn02_00246218 predicted 886
10 SASI_Rn02_00246219 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194779 predicted 1002
2 SASI_Mm01_00194780 predicted 1648
3 SASI_Mm01_00194782 predicted 1047
4 SASI_Mm01_00194783 predicted 1509
5 SASI_Mm02_00317862 predicted 1003
6 SASI_Mm01_00194784 predicted 1456
7 SASI_Mm01_00194785 predicted 1530
8 SASI_Mm02_00317863 predicted 1263
9 SASI_Mm01_00194786 predicted 1653
10 SASI_Mm02_00317864 predicted 1267
11 SASI_Mm01_00194781 predicted 1071
12 SASI_Mm01_00194787 predicted 204
13 SASI_Mm01_00194788 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010134
EN2 MISSION shRNA Bacterial Glycerol Stock
engrailed homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010134.1-1065s1c1
Sequence:CCGGGCGCGAAACAATGCAATAATTCTCGAGAATTATTGCATTGTTTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-926s1c1
Sequence:CCGGCACGGGCAACAAGAACACTTTCTCGAGAAAGTGTTCTTGTTGCCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-679s1c1
Sequence:CCGGCGCGCTATTCTGACCGGCCTTCTCGAGAAGGCCGGTCAGAATAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-224s1c1
Sequence:CCGGACATCGCATCACCAACTTCTTCTCGAGAAGAAGTTGGTGATGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-734s1c1
Sequence:CCGGGAACCCTAACAAAGAGGACAACTCGAGTTGTCCTCTTTGTTAGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010134
EN2 MISSION shRNA shRNA Plasmid DNA
engrailed homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010134.1-1065s1c1
Sequence:CCGGGCGCGAAACAATGCAATAATTCTCGAGAATTATTGCATTGTTTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-926s1c1
Sequence:CCGGCACGGGCAACAAGAACACTTTCTCGAGAAAGTGTTCTTGTTGCCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-679s1c1
Sequence:CCGGCGCGCTATTCTGACCGGCCTTCTCGAGAAGGCCGGTCAGAATAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-224s1c1
Sequence:CCGGACATCGCATCACCAACTTCTTCTCGAGAAGAAGTTGGTGATGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-734s1c1
Sequence:CCGGGAACCCTAACAAAGAGGACAACTCGAGTTGTCCTCTTTGTTAGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010134
EN2 MISSION shRNA Lentiviral Transduction Particles
engrailed homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010134.1-1065s1c1
Sequence:CCGGGCGCGAAACAATGCAATAATTCTCGAGAATTATTGCATTGTTTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-926s1c1
Sequence:CCGGCACGGGCAACAAGAACACTTTCTCGAGAAAGTGTTCTTGTTGCCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-679s1c1
Sequence:CCGGCGCGCTATTCTGACCGGCCTTCTCGAGAAGGCCGGTCAGAATAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-224s1c1
Sequence:CCGGACATCGCATCACCAACTTCTTCTCGAGAAGAAGTTGGTGATGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010134.1-734s1c1
Sequence:CCGGGAACCCTAACAAAGAGGACAACTCGAGTTGTCCTCTTTGTTAGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001427
EN2 MISSION shRNA Bacterial Glycerol Stock
engrailed homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001427.2-3078s1c1
Sequence:CCGGCCGAATAAATAGCTCCTATTTCTCGAGAAATAGGAGCTATTTATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2370s1c1
Sequence:CCGGACCAAAGAAGAAGAACCCGAACTCGAGTTCGGGTTCTTCTTCTTTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-1860s1c1
Sequence:CCGGCCGCATCACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTGATGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2451s1c1
Sequence:CCGGCGAGTTCCAGACCAACAGGTACTCGAGTACCTGTTGGTCTGGAACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2382s1c1
Sequence:CCGGGAACCCGAACAAAGAGGACAACTCGAGTTGTCCTCTTTGTTCGGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001427
EN2 MISSION shRNA shRNA Plasmid DNA
engrailed homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001427.2-3078s1c1
Sequence:CCGGCCGAATAAATAGCTCCTATTTCTCGAGAAATAGGAGCTATTTATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2370s1c1
Sequence:CCGGACCAAAGAAGAAGAACCCGAACTCGAGTTCGGGTTCTTCTTCTTTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-1860s1c1
Sequence:CCGGCCGCATCACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTGATGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2451s1c1
Sequence:CCGGCGAGTTCCAGACCAACAGGTACTCGAGTACCTGTTGGTCTGGAACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2382s1c1
Sequence:CCGGGAACCCGAACAAAGAGGACAACTCGAGTTGTCCTCTTTGTTCGGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001427
EN2 MISSION shRNA Lentiviral Transduction Particles
engrailed homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001427.2-3078s1c1
Sequence:CCGGCCGAATAAATAGCTCCTATTTCTCGAGAAATAGGAGCTATTTATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2370s1c1
Sequence:CCGGACCAAAGAAGAAGAACCCGAACTCGAGTTCGGGTTCTTCTTCTTTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-1860s1c1
Sequence:CCGGCCGCATCACCAACTTCTTCATCTCGAGATGAAGAAGTTGGTGATGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2451s1c1
Sequence:CCGGCGAGTTCCAGACCAACAGGTACTCGAGTACCTGTTGGTCTGGAACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001427.2-2382s1c1
Sequence:CCGGGAACCCGAACAAAGAGGACAACTCGAGTTGTCCTCTTTGTTCGGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)