EMAIL THIS PAGE TO A FRIEND

ENAH

enabled homolog (Drosophila)

Synonyms: ENA MENA NDPP1
Gene ID:
Mouse(13800) enabled homolog (Drosophila)
Rat(360891) enabled homolog (Drosophila)
domestic guinea pig(100720009) enabled homolog (Drosophila)
naked mole-rat(101706471) enabled homolog (Drosophila)
Zebrafish(541394) enabled homolog (Drosophila)
cow(513095) enabled homolog (Drosophila)
domestic cat(101085263) enabled homolog (Drosophila)
chicken(374180) enabled homolog (Drosophila)
Gene Class: Cytoskeleton
291 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069041 MISSION® esiRNA esiRNA targeting mouse Enah (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008493 Rosetta Predictions human pricing
NM_018212 Rosetta Predictions human pricing
NM_001012150 Rosetta Predictions rat pricing
XM_573530 Rosetta Predictions rat pricing
NM_001083120 Rosetta Predictions mouse pricing
NM_001083121 Rosetta Predictions mouse pricing
NM_008680 Rosetta Predictions mouse pricing
NM_010135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098817 predicted 2684
2 SASI_Hs01_00098818 predicted 2625
3 SASI_Hs01_00098819 predicted 2724
4 SASI_Hs01_00098820 predicted 2312
5 SASI_Hs01_00098821 predicted 2373
6 SASI_Hs01_00098822 predicted 2439
7 SASI_Hs01_00098823 predicted 654
8 SASI_Hs01_00098824 predicted 2658
9 SASI_Hs01_00098825 predicted 2273
10 SASI_Hs01_00098826 predicted 2692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061271 predicted 2618
2 SASI_Hs01_00061272 predicted 2567
3 SASI_Hs01_00061273 predicted 2665
4 SASI_Hs01_00061274 predicted 2241
5 SASI_Hs01_00061275 predicted 2307
6 SASI_Hs01_00061276 predicted 2369
7 SASI_Hs01_00061277 predicted 649
8 SASI_Hs01_00061278 predicted 2600
9 SASI_Hs01_00061279 predicted 2216
10 SASI_Hs01_00061280 predicted 2632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033581 predicted 353
2 SASI_Rn01_00033582 predicted 356
3 SASI_Rn01_00033583 predicted 1485
4 SASI_Rn01_00033584 predicted 401
5 SASI_Rn01_00033586 predicted 413
6 SASI_Rn01_00033587 predicted 1609
7 SASI_Rn01_00033588 predicted 252
8 SASI_Rn01_00033589 predicted 1415
9 SASI_Rn01_00033590 predicted 1586
10 SASI_Rn02_00200329 predicted 341
11 SASI_Rn01_00033585 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158739 predicted 2216
2 SASI_Rn01_00158740 predicted 2362
3 SASI_Rn01_00158741 predicted 2603
4 SASI_Rn01_00158742 predicted 2109
5 SASI_Rn01_00158743 predicted 2479
6 SASI_Rn01_00158744 predicted 2205
7 SASI_Rn01_00158745 predicted 2487
8 SASI_Rn01_00158746 predicted 2472
9 SASI_Rn01_00158747 predicted 2468
10 SASI_Rn01_00158748 predicted 2372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299494 predicted 3248
2 SASI_Mm02_00299495 predicted 2670
3 SASI_Mm02_00299496 predicted 3277
4 SASI_Mm02_00299497 predicted 3270
5 SASI_Mm02_00299498 predicted 3042
6 SASI_Mm02_00299499 predicted 2981
7 SASI_Mm02_00299500 predicted 2902
8 SASI_Mm02_00299501 predicted 3236
9 SASI_Mm02_00299502 predicted 449
10 SASI_Mm02_00299503 predicted 3210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299504 predicted 2518
2 SASI_Mm02_00299505 predicted 1938
3 SASI_Mm02_00299506 predicted 2548
4 SASI_Mm02_00299507 predicted 2532
5 SASI_Mm02_00299508 predicted 2310
6 SASI_Mm02_00299509 predicted 2246
7 SASI_Mm02_00299510 predicted 2169
8 SASI_Mm02_00299511 predicted 2505
9 SASI_Mm02_00299512 predicted 452
10 SASI_Mm02_00299513 predicted 2474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314453 predicted 3261
2 SASI_Mm02_00314454 predicted 2681
3 SASI_Mm02_00314455 predicted 3295
4 SASI_Mm02_00314456 predicted 3275
5 SASI_Mm02_00314457 predicted 3051
6 SASI_Mm02_00314458 predicted 2994
7 SASI_Mm02_00314459 predicted 2913
8 SASI_Mm02_00314460 predicted 3244
9 SASI_Mm02_00314461 predicted 446
10 SASI_Mm02_00314462 predicted 3224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317865 predicted 3304
2 SASI_Mm01_00073628 predicted 2729
3 SASI_Mm02_00317866 predicted 3342
4 SASI_Mm02_00317867 predicted 3324
5 SASI_Mm02_00317868 predicted 3100
6 SASI_Mm02_00317869 predicted 3042
7 SASI_Mm01_00073633 predicted 2955
8 SASI_Mm02_00317870 predicted 3289
9 SASI_Mm02_00317871 predicted 454
10 SASI_Mm02_00317872 predicted 3268
11 SASI_Mm01_00073626 predicted 390
12 SASI_Mm01_00073627 predicted 399
13 SASI_Mm01_00073629 predicted 339
14 SASI_Mm01_00073630 predicted 417
15 SASI_Mm01_00073631 predicted 450
16 SASI_Mm01_00073632 predicted 292
17 SASI_Mm01_00073634 predicted 2402
18 SASI_Mm01_00073635 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018212
VALIDATED
ENAH MISSION shRNA Bacterial Glycerol Stock
enabled homolog (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-856s1c1
Sequence:CCGGCCATCCCAAGAAGAATTGGAACTCGAGTTCCAATTCTTCTTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-2136s1c1
Sequence:CCGGGCAGGAACTGAGCAAGTCAAACTCGAGTTTGACTTGCTCAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018212.4-2246s1c1
Sequence:CCGGCCCTACATTTATGAGCTGTAACTCGAGTTACAGCTCATAAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-625s1c1
Sequence:CCGGGTCGTGATAAACTGTGCCATTCTCGAGAATGGCACAGTTTATCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-1265s1c1
Sequence:CCGGCCTCTGTTGAGACTCCTCTAACTCGAGTTAGAGGAGTCTCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-768s21c1
Sequence:CCGGGCATGCCTTAGAAGTGTTAAACTCGAGTTTAACACTTCTAAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-2136s21c1
Sequence:CCGGGCAGGAACTGAGCAAGTCAAACTCGAGTTTGACTTGCTCAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-481s21c1
Sequence:CCGGAGAGCTGCTGTGATGGTTTATCTCGAGATAAACCATCACAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-1735s21c1
Sequence:CCGGACAGATACAGGCCGTGGAAATCTCGAGATTTCCACGGCCTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018212.4-707s21c1
Sequence:CCGGAGGTGTATGGTCTCAACTTTGCTCGAGCAAAGTTGAGACCATACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-2487s21c1
Sequence:CCGGTCAAGATAAAGTCGCACATTTCTCGAGAAATGTGCGACTTTATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-1225s21c1
Sequence:CCGGTGGGAGAGAGAGCGCAGAATACTCGAGTATTCTGCGCTCTCTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018212
VALIDATED
ENAH MISSION shRNA shRNA Plasmid DNA
enabled homolog (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-856s1c1
Sequence:CCGGCCATCCCAAGAAGAATTGGAACTCGAGTTCCAATTCTTCTTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-2136s1c1
Sequence:CCGGGCAGGAACTGAGCAAGTCAAACTCGAGTTTGACTTGCTCAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018212.4-2246s1c1
Sequence:CCGGCCCTACATTTATGAGCTGTAACTCGAGTTACAGCTCATAAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-625s1c1
Sequence:CCGGGTCGTGATAAACTGTGCCATTCTCGAGAATGGCACAGTTTATCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-1265s1c1
Sequence:CCGGCCTCTGTTGAGACTCCTCTAACTCGAGTTAGAGGAGTCTCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-768s21c1
Sequence:CCGGGCATGCCTTAGAAGTGTTAAACTCGAGTTTAACACTTCTAAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-2136s21c1
Sequence:CCGGGCAGGAACTGAGCAAGTCAAACTCGAGTTTGACTTGCTCAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-481s21c1
Sequence:CCGGAGAGCTGCTGTGATGGTTTATCTCGAGATAAACCATCACAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-1735s21c1
Sequence:CCGGACAGATACAGGCCGTGGAAATCTCGAGATTTCCACGGCCTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018212.4-707s21c1
Sequence:CCGGAGGTGTATGGTCTCAACTTTGCTCGAGCAAAGTTGAGACCATACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-2487s21c1
Sequence:CCGGTCAAGATAAAGTCGCACATTTCTCGAGAAATGTGCGACTTTATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-1225s21c1
Sequence:CCGGTGGGAGAGAGAGCGCAGAATACTCGAGTATTCTGCGCTCTCTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018212
VALIDATED
ENAH MISSION shRNA Lentiviral Transduction Particles
enabled homolog (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-856s1c1
Sequence:CCGGCCATCCCAAGAAGAATTGGAACTCGAGTTCCAATTCTTCTTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-2136s1c1
Sequence:CCGGGCAGGAACTGAGCAAGTCAAACTCGAGTTTGACTTGCTCAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018212.4-2246s1c1
Sequence:CCGGCCCTACATTTATGAGCTGTAACTCGAGTTACAGCTCATAAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-625s1c1
Sequence:CCGGGTCGTGATAAACTGTGCCATTCTCGAGAATGGCACAGTTTATCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018212.4-1265s1c1
Sequence:CCGGCCTCTGTTGAGACTCCTCTAACTCGAGTTAGAGGAGTCTCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-768s21c1
Sequence:CCGGGCATGCCTTAGAAGTGTTAAACTCGAGTTTAACACTTCTAAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-2136s21c1
Sequence:CCGGGCAGGAACTGAGCAAGTCAAACTCGAGTTTGACTTGCTCAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-481s21c1
Sequence:CCGGAGAGCTGCTGTGATGGTTTATCTCGAGATAAACCATCACAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-1735s21c1
Sequence:CCGGACAGATACAGGCCGTGGAAATCTCGAGATTTCCACGGCCTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018212.4-707s21c1
Sequence:CCGGAGGTGTATGGTCTCAACTTTGCTCGAGCAAAGTTGAGACCATACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-2487s21c1
Sequence:CCGGTCAAGATAAAGTCGCACATTTCTCGAGAAATGTGCGACTTTATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018212.4-1225s21c1
Sequence:CCGGTGGGAGAGAGAGCGCAGAATACTCGAGTATTCTGCGCTCTCTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010135
VALIDATED
ENAH MISSION shRNA Bacterial Glycerol Stock
enabled homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-2568s1c1
Sequence:CCGGGCAGGACTTGAATCTGGAGAACTCGAGTTCTCCAGATTCAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-455s1c1
Sequence:CCGGCATGCCTTAGAAGTGTTAAATCTCGAGATTTAACACTTCTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-1983s1c1
Sequence:CCGGCAGAAGACAATCGCCCTTTAACTCGAGTTAAAGGGCGATTGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010135.1-519s1c1
Sequence:CCGGGCACTAATTTGCGATGTATTTCTCGAGAAATACATCGCAAATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-2527s1c1
Sequence:CCGGGAGCAAGTCGAACACTGCATACTCGAGTATGCAGTGTTCGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-762s21c1
Sequence:CCGGCATGCCTTAGAAGTGTTAAATCTCGAGATTTAACACTTCTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2881s21c1
Sequence:CCGGGCAGGACTTGAATCTGGAGAACTCGAGTTCTCCAGATTCAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2296s21c1
Sequence:CCGGCAGAAGACAATCGCCCTTTAACTCGAGTTAAAGGGCGATTGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2840s21c1
Sequence:CCGGGAGCAAGTCGAACACTGCATACTCGAGTATGCAGTGTTCGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010135
VALIDATED
ENAH MISSION shRNA shRNA Plasmid DNA
enabled homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-2568s1c1
Sequence:CCGGGCAGGACTTGAATCTGGAGAACTCGAGTTCTCCAGATTCAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-455s1c1
Sequence:CCGGCATGCCTTAGAAGTGTTAAATCTCGAGATTTAACACTTCTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-1983s1c1
Sequence:CCGGCAGAAGACAATCGCCCTTTAACTCGAGTTAAAGGGCGATTGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010135.1-519s1c1
Sequence:CCGGGCACTAATTTGCGATGTATTTCTCGAGAAATACATCGCAAATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-2527s1c1
Sequence:CCGGGAGCAAGTCGAACACTGCATACTCGAGTATGCAGTGTTCGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-762s21c1
Sequence:CCGGCATGCCTTAGAAGTGTTAAATCTCGAGATTTAACACTTCTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2881s21c1
Sequence:CCGGGCAGGACTTGAATCTGGAGAACTCGAGTTCTCCAGATTCAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2296s21c1
Sequence:CCGGCAGAAGACAATCGCCCTTTAACTCGAGTTAAAGGGCGATTGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2840s21c1
Sequence:CCGGGAGCAAGTCGAACACTGCATACTCGAGTATGCAGTGTTCGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010135
VALIDATED
ENAH MISSION shRNA Lentiviral Transduction Particles
enabled homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-2568s1c1
Sequence:CCGGGCAGGACTTGAATCTGGAGAACTCGAGTTCTCCAGATTCAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-455s1c1
Sequence:CCGGCATGCCTTAGAAGTGTTAAATCTCGAGATTTAACACTTCTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-1983s1c1
Sequence:CCGGCAGAAGACAATCGCCCTTTAACTCGAGTTAAAGGGCGATTGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010135.1-519s1c1
Sequence:CCGGGCACTAATTTGCGATGTATTTCTCGAGAAATACATCGCAAATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010135.1-2527s1c1
Sequence:CCGGGAGCAAGTCGAACACTGCATACTCGAGTATGCAGTGTTCGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-762s21c1
Sequence:CCGGCATGCCTTAGAAGTGTTAAATCTCGAGATTTAACACTTCTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2881s21c1
Sequence:CCGGGCAGGACTTGAATCTGGAGAACTCGAGTTCTCCAGATTCAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2296s21c1
Sequence:CCGGCAGAAGACAATCGCCCTTTAACTCGAGTTAAAGGGCGATTGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010135.2-2840s21c1
Sequence:CCGGGAGCAAGTCGAACACTGCATACTCGAGTATGCAGTGTTCGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks