EMAIL THIS PAGE TO A FRIEND

ENAM

enamelin

158 Gene Product Result for
Synonyms: ADAI AI1C AIH2
UniProtKB ID: Q9NRM1, Q17RI5, Q9H3D1
Gene ID:
Human(10117) Summary: Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
Mouse(13801) enamelin
Rat(289525) enamelin
cow(527075) enamelin
dog(482186) enamelin
sheep(101121349) enamelin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026621 MISSION® esiRNA esiRNA human ENAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031889 Rosetta Predictions human pricing
NM_001106001 Rosetta Predictions rat pricing
NM_017468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358994 predicted 2327
2 SASI_Hs01_00151169 predicted 3675
3 SASI_Hs01_00151171 predicted 3412
4 SASI_Hs01_00151172 predicted 3624
5 SASI_Hs02_00358995 predicted 2107
6 SASI_Hs01_00151173 predicted 3590
7 SASI_Hs01_00151174 predicted 3133
8 SASI_Hs01_00151175 predicted 1843
9 SASI_Hs01_00151177 predicted 1119
10 SASI_Hs02_00358996 predicted 2539
11 SASI_Hs01_00151168 predicted 2221
12 SASI_Hs01_00151170 predicted 3340
13 SASI_Hs01_00151176 predicted 3430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214652 predicted 2045
2 SASI_Rn02_00214653 predicted 3113
3 SASI_Rn02_00214654 predicted 1826
4 SASI_Rn02_00214655 predicted 3262
5 SASI_Rn02_00214656 predicted 2478
6 SASI_Rn02_00214657 predicted 2696
7 SASI_Rn02_00214658 predicted 2400
8 SASI_Rn02_00214659 predicted 2837
9 SASI_Rn02_00214660 predicted 1055
10 SASI_Rn02_00214661 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112094 predicted 3401
2 SASI_Mm01_00112096 predicted 2398
3 SASI_Mm01_00112097 predicted 1326
4 SASI_Mm01_00112098 predicted 1975
5 SASI_Mm02_00323930 predicted 3077
6 SASI_Mm02_00323931 predicted 1596
7 SASI_Mm01_00112099 predicted 3342
8 SASI_Mm01_00112100 predicted 2656
9 SASI_Mm01_00112101 predicted 1890
10 SASI_Mm01_00112102 predicted 1755
11 SASI_Mm01_00112095 predicted 3038
12 SASI_Mm01_00112103 predicted 2488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031889
ENAM MISSION shRNA Bacterial Glycerol Stock
enamelin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-2216s21c1
Sequence:CCGGGAAGGAGATAGTCCCTTATAACTCGAGTTATAAGGGACTATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-1701s21c1
Sequence:CCGGCCTCACTCTGAGGGTTATATGCTCGAGCATATAACCCTCAGAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-869s21c1
Sequence:CCGGGAATCCTTACTTTGGATATTTCTCGAGAAATATCCAAAGTAAGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-3558s1c1
Sequence:CCGGCCTAACACATTGGTTGAGTTACTCGAGTAACTCAACCAATGTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031889.1-4068s1c1
Sequence:CCGGGCAGATTAACTTTCCATTCTACTCGAGTAGAATGGAAAGTTAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-915s1c1
Sequence:CCGGCCTCCTTATTATTCAGAAGAACTCGAGTTCTTCTGAATAATAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-1555s1c1
Sequence:CCGGGCCCTGTTGTTCGCAATGAAACTCGAGTTTCATTGCGAACAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-455s1c1
Sequence:CCGGGCGGTATAATCAATTCAACTTCTCGAGAAGTTGAATTGATTATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031889
ENAM MISSION shRNA shRNA Plasmid DNA
enamelin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-2216s21c1
Sequence:CCGGGAAGGAGATAGTCCCTTATAACTCGAGTTATAAGGGACTATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-1701s21c1
Sequence:CCGGCCTCACTCTGAGGGTTATATGCTCGAGCATATAACCCTCAGAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-869s21c1
Sequence:CCGGGAATCCTTACTTTGGATATTTCTCGAGAAATATCCAAAGTAAGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-3558s1c1
Sequence:CCGGCCTAACACATTGGTTGAGTTACTCGAGTAACTCAACCAATGTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031889.1-4068s1c1
Sequence:CCGGGCAGATTAACTTTCCATTCTACTCGAGTAGAATGGAAAGTTAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-915s1c1
Sequence:CCGGCCTCCTTATTATTCAGAAGAACTCGAGTTCTTCTGAATAATAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-1555s1c1
Sequence:CCGGGCCCTGTTGTTCGCAATGAAACTCGAGTTTCATTGCGAACAACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-455s1c1
Sequence:CCGGGCGGTATAATCAATTCAACTTCTCGAGAAGTTGAATTGATTATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031889
ENAM MISSION shRNA Lentiviral Transduction Particles
enamelin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-2216s21c1
Sequence:CCGGGAAGGAGATAGTCCCTTATAACTCGAGTTATAAGGGACTATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-1701s21c1
Sequence:CCGGCCTCACTCTGAGGGTTATATGCTCGAGCATATAACCCTCAGAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031889.2-869s21c1
Sequence:CCGGGAATCCTTACTTTGGATATTTCTCGAGAAATATCCAAAGTAAGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-3558s1c1
Sequence:CCGGCCTAACACATTGGTTGAGTTACTCGAGTAACTCAACCAATGTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031889.1-4068s1c1
Sequence:CCGGGCAGATTAACTTTCCATTCTACTCGAGTAGAATGGAAAGTTAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-915s1c1
Sequence:CCGGCCTCCTTATTATTCAGAAGAACTCGAGTTCTTCTGAATAATAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-1555s1c1
Sequence:CCGGGCCCTGTTGTTCGCAATGAAACTCGAGTTTCATTGCGAACAACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031889.1-455s1c1
Sequence:CCGGGCGGTATAATCAATTCAACTTCTCGAGAAGTTGAATTGATTATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017468
ENAM MISSION shRNA Bacterial Glycerol Stock
enamelin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-1774s1c1
Sequence:CCGGGCCGCAAACAAACCATCTATACTCGAGTATAGATGGTTTGTTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-1147s1c1
Sequence:CCGGGCTGGGAACAATCCTACAGTTCTCGAGAACTGTAGGATTGTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-3982s1c1
Sequence:CCGGCCTAACACATTGGTTGGGTTACTCGAGTAACCCAACCAATGTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-2301s1c1
Sequence:CCGGCCCATTTCAATCAGAAACTAACTCGAGTTAGTTTCTGATTGAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-3423s1c1
Sequence:CCGGGCATACAGAAAGCAGTTATATCTCGAGATATAACTGCTTTCTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017468
ENAM MISSION shRNA shRNA Plasmid DNA
enamelin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-1774s1c1
Sequence:CCGGGCCGCAAACAAACCATCTATACTCGAGTATAGATGGTTTGTTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-1147s1c1
Sequence:CCGGGCTGGGAACAATCCTACAGTTCTCGAGAACTGTAGGATTGTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-3982s1c1
Sequence:CCGGCCTAACACATTGGTTGGGTTACTCGAGTAACCCAACCAATGTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-2301s1c1
Sequence:CCGGCCCATTTCAATCAGAAACTAACTCGAGTTAGTTTCTGATTGAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-3423s1c1
Sequence:CCGGGCATACAGAAAGCAGTTATATCTCGAGATATAACTGCTTTCTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017468
ENAM MISSION shRNA Lentiviral Transduction Particles
enamelin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-1774s1c1
Sequence:CCGGGCCGCAAACAAACCATCTATACTCGAGTATAGATGGTTTGTTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-1147s1c1
Sequence:CCGGGCTGGGAACAATCCTACAGTTCTCGAGAACTGTAGGATTGTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-3982s1c1
Sequence:CCGGCCTAACACATTGGTTGGGTTACTCGAGTAACCCAACCAATGTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-2301s1c1
Sequence:CCGGCCCATTTCAATCAGAAACTAACTCGAGTTAGTTTCTGATTGAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017468.1-3423s1c1
Sequence:CCGGGCATACAGAAAGCAGTTATATCTCGAGATATAACTGCTTTCTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)