EMAIL THIS PAGE TO A FRIEND

ENC1

ectodermal-neural cortex 1 (with BTB domain)

84 Gene Product Result for
Synonyms: CCL28 ENC-1 KLHL35 KLHL37 NRPB PIG10 TP53I10
UniProtKB ID: O14682, B4DHJ1, E9PFU0, O75464, Q9UPG9
Gene ID:
Human(8507) Summary: This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(13803) ectodermal-neural cortex 1
Rat(294674) ectodermal-neural cortex 1
Zebrafish(327531) ectodermal-neural cortex (with BTB-like domain)
chicken(427203) ectodermal-neural cortex 1 (with BTB-like domain)
dog(487247) ectodermal-neural cortex 1 (with BTB-like domain)
Horse(100073290) ectodermal-neural cortex 1 (with BTB-like domain)
cow(617091) ectodermal-neural cortex 1 (with BTB-like domain)
domestic cat(101097451) ectodermal-neural cortex 1 (with BTB-like domain)
sheep(101112420) ectodermal-neural cortex 1 (with BTB-like domain)
Domestic Rabbit(100340610) ectodermal-neural cortex 1 (with BTB-like domain)
domestic guinea pig(100734200) ectodermal-neural cortex 1 (with BTB domain)
naked mole-rat(101710242) ectodermal-neural cortex 1 (with BTB domain)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003633 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011301 MISSION® esiRNA esiRNA targeting human ENC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003633 Rosetta Predictions human pricing
NM_001003401 Rosetta Predictions rat pricing
XM_579096 Rosetta Predictions rat pricing
NM_007930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033398 predicted 1626
2 SASI_Hs01_00033400 predicted 1919
3 SASI_Hs01_00033401 predicted 445
4 SASI_Hs02_00335985 predicted 668
5 SASI_Hs02_00335986 predicted 2160
6 SASI_Hs01_00033403 predicted 1386
7 SASI_Hs01_00033404 predicted 1226
8 SASI_Hs01_00033405 predicted 1362
9 SASI_Hs01_00033406 predicted 1457
10 SASI_Hs01_00033407 predicted 2114
11 SASI_Hs01_00033399 predicted 1625
12 SASI_Hs01_00033402 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198033 predicted 1101
2 SASI_Rn01_00034693 predicted 968
3 SASI_Rn01_00034694 predicted 832
4 SASI_Rn02_00198034 predicted 694
5 SASI_Rn01_00034696 predicted 371
6 SASI_Rn01_00034697 predicted 1376
7 SASI_Rn02_00198035 predicted 993
8 SASI_Rn01_00034699 predicted 829
9 SASI_Rn01_00034701 predicted 1548
10 SASI_Rn02_00198036 predicted 1275
11 SASI_Rn01_00034692 predicted 603
12 SASI_Rn01_00034695 predicted 1405
13 SASI_Rn01_00034698 predicted 972
14 SASI_Rn01_00034700 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136339 predicted 1274
2 SASI_Rn01_00136340 predicted 568
3 SASI_Rn01_00136341 predicted 1627
4 SASI_Rn01_00136342 predicted 1580
5 SASI_Rn01_00136343 predicted 1304
6 SASI_Rn01_00136344 predicted 1666
7 SASI_Rn01_00136345 predicted 1371
8 SASI_Rn01_00136346 predicted 1344
9 SASI_Rn01_00136347 predicted 719
10 SASI_Rn01_00136348 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187732 predicted 2121
2 SASI_Mm01_00187733 predicted 1684
3 SASI_Mm01_00187734 predicted 640
4 SASI_Mm01_00187735 predicted 875
5 SASI_Mm01_00187736 predicted 1376
6 SASI_Mm02_00312766 predicted 876
7 SASI_Mm01_00187737 predicted 1412
8 SASI_Mm01_00187738 predicted 1745
9 SASI_Mm01_00187739 predicted 999
10 SASI_Mm01_00187740 predicted 1028
11 SASI_Mm01_00187741 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007930
VALIDATED
ENC1 MISSION shRNA Bacterial Glycerol Stock
ectodermal-neural cortex 1 (with BTB domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007930.3-4485s1c1
Sequence:CCGGGCCGCATAATATCCCTCTCTTCTCGAGAAGAGAGGGATATTATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-1890s1c1
Sequence:CCGGGCTCCGCTTACAAATTCAATACTCGAGTATTGAATTTGTAAGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-659s1c1
Sequence:CCGGGAAGTCTTAGAGCTGCTTCTACTCGAGTAGAAGCAGCTCTAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007930.3-907s1c1
Sequence:CCGGCATTCGGAAGAACGAAGATTTCTCGAGAAATCTTCGTTCTTCCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-1751s1c1
Sequence:CCGGCCCAAGGTTCAGTGTTACGATCTCGAGATCGTAACACTGAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007930
VALIDATED
ENC1 MISSION shRNA shRNA Plasmid DNA
ectodermal-neural cortex 1 (with BTB domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007930.3-4485s1c1
Sequence:CCGGGCCGCATAATATCCCTCTCTTCTCGAGAAGAGAGGGATATTATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-1890s1c1
Sequence:CCGGGCTCCGCTTACAAATTCAATACTCGAGTATTGAATTTGTAAGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-659s1c1
Sequence:CCGGGAAGTCTTAGAGCTGCTTCTACTCGAGTAGAAGCAGCTCTAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007930.3-907s1c1
Sequence:CCGGCATTCGGAAGAACGAAGATTTCTCGAGAAATCTTCGTTCTTCCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-1751s1c1
Sequence:CCGGCCCAAGGTTCAGTGTTACGATCTCGAGATCGTAACACTGAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007930
VALIDATED
ENC1 MISSION shRNA Lentiviral Transduction Particles
ectodermal-neural cortex 1 (with BTB domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007930.3-4485s1c1
Sequence:CCGGGCCGCATAATATCCCTCTCTTCTCGAGAAGAGAGGGATATTATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-1890s1c1
Sequence:CCGGGCTCCGCTTACAAATTCAATACTCGAGTATTGAATTTGTAAGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-659s1c1
Sequence:CCGGGAAGTCTTAGAGCTGCTTCTACTCGAGTAGAAGCAGCTCTAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007930.3-907s1c1
Sequence:CCGGCATTCGGAAGAACGAAGATTTCTCGAGAAATCTTCGTTCTTCCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007930.3-1751s1c1
Sequence:CCGGCCCAAGGTTCAGTGTTACGATCTCGAGATCGTAACACTGAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003633
VALIDATED
ENC1 MISSION shRNA Bacterial Glycerol Stock
ectodermal-neural cortex 1 (with BTB domain)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-2147s1c1
Sequence:CCGGCCTGGAAACATCTGCCTTCTTCTCGAGAAGAAGGCAGATGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-891s1c1
Sequence:CCGGGTACGAACTATCTTGGAGAATCTCGAGATTCTCCAAGATAGTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-444s1c1
Sequence:CCGGCGGCTCCATTAACATCTATCTCTCGAGAGATAGATGTTAATGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-1032s1c1
Sequence:CCGGCGAGTCTGCAATTAACTGGATCTCGAGATCCAGTTAATTGCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003633.1-1777s1c1
Sequence:CCGGCCCAAAGTTCAGTGTTACGATCTCGAGATCGTAACACTGAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1614s21c1
Sequence:CCGGCACCAAGCTGTACGAACTATCCTCGAGGATAGTTCGTACAGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-2797s21c1
Sequence:CCGGGACTGCTACGATCCAACATTACTCGAGTAATGTTGGATCGTAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003633.2-4835s21c1
Sequence:CCGGGCATAGTCAGTGTCGTTTATACTCGAGTATAAACGACACTGACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1790s21c1
Sequence:CCGGATGACCTGAAGAAGCGCTATTCTCGAGAATAGCGCTTCTTCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1759s21c1
Sequence:CCGGGTGTACGAGTCTGCAATTAACCTCGAGGTTAATTGCAGACTCGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003633
VALIDATED
ENC1 MISSION shRNA shRNA Plasmid DNA
ectodermal-neural cortex 1 (with BTB domain)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-2147s1c1
Sequence:CCGGCCTGGAAACATCTGCCTTCTTCTCGAGAAGAAGGCAGATGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-891s1c1
Sequence:CCGGGTACGAACTATCTTGGAGAATCTCGAGATTCTCCAAGATAGTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-444s1c1
Sequence:CCGGCGGCTCCATTAACATCTATCTCTCGAGAGATAGATGTTAATGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-1032s1c1
Sequence:CCGGCGAGTCTGCAATTAACTGGATCTCGAGATCCAGTTAATTGCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003633.1-1777s1c1
Sequence:CCGGCCCAAAGTTCAGTGTTACGATCTCGAGATCGTAACACTGAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1614s21c1
Sequence:CCGGCACCAAGCTGTACGAACTATCCTCGAGGATAGTTCGTACAGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-2797s21c1
Sequence:CCGGGACTGCTACGATCCAACATTACTCGAGTAATGTTGGATCGTAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003633.2-4835s21c1
Sequence:CCGGGCATAGTCAGTGTCGTTTATACTCGAGTATAAACGACACTGACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1790s21c1
Sequence:CCGGATGACCTGAAGAAGCGCTATTCTCGAGAATAGCGCTTCTTCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1759s21c1
Sequence:CCGGGTGTACGAGTCTGCAATTAACCTCGAGGTTAATTGCAGACTCGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003633
VALIDATED
ENC1 MISSION shRNA Lentiviral Transduction Particles
ectodermal-neural cortex 1 (with BTB domain)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-2147s1c1
Sequence:CCGGCCTGGAAACATCTGCCTTCTTCTCGAGAAGAAGGCAGATGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-891s1c1
Sequence:CCGGGTACGAACTATCTTGGAGAATCTCGAGATTCTCCAAGATAGTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-444s1c1
Sequence:CCGGCGGCTCCATTAACATCTATCTCTCGAGAGATAGATGTTAATGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003633.1-1032s1c1
Sequence:CCGGCGAGTCTGCAATTAACTGGATCTCGAGATCCAGTTAATTGCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003633.1-1777s1c1
Sequence:CCGGCCCAAAGTTCAGTGTTACGATCTCGAGATCGTAACACTGAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1614s21c1
Sequence:CCGGCACCAAGCTGTACGAACTATCCTCGAGGATAGTTCGTACAGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-2797s21c1
Sequence:CCGGGACTGCTACGATCCAACATTACTCGAGTAATGTTGGATCGTAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003633.2-4835s21c1
Sequence:CCGGGCATAGTCAGTGTCGTTTATACTCGAGTATAAACGACACTGACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1790s21c1
Sequence:CCGGATGACCTGAAGAAGCGCTATTCTCGAGAATAGCGCTTCTTCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003633.2-1759s21c1
Sequence:CCGGGTGTACGAGTCTGCAATTAACCTCGAGGTTAATTGCAGACTCGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks