EMAIL THIS PAGE TO A FRIEND

ENDOG

endonuclease G

UniProtKB ID: Q14249, Q5T281, Q9BSP2
Gene ID:
Human(2021) Summary: The protein encoded by this gene is a nuclear encoded endonuclease that is localized in the mitochondrion. The encoded protein is widely distributed among animals and cleaves DNA at GC tracts. This protein is capable of generating the RNA primers required by DNA polymerase gamma to initiate replication of mitochondrial DNA. [provided by RefSeq, Jul 2008]
Mouse(13804) endonuclease G
Rat(362100) endonuclease G
sheep(780458) endonuclease G
naked mole-rat(101717186) endonuclease G
Zebrafish(100002293) endonuclease G
cow(327707) endonuclease G
domestic cat(768264) endonuclease G
dog(608916) endonuclease G
chicken(417204) endonuclease G
fruit fly(36309) Endonuclease G
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500213 Anti-EndoG antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
HPA021335 Anti-ENDOG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry pricing
HPA021830 Anti-ENDOG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry pricing
SAB2103518 Anti-ENDOG antibody produced in rabbit affinity isolated antibody , rat, canine, human, guinea pig, bovine, zebrafish, mouse, horse
western blot pricing
SAB1405757 Anti-ENDOG, (C-terminal) antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
E5654 Anti-Endonuclease G antibody produced in rabbit 1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB3500468 Monoclonal Anti-EndoG antibody produced in mouse clone 7G1C10, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB3500469 Monoclonal Anti-EndoG antibody produced in mouse clone 7G1G10, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB3500470 Monoclonal Anti-EndoG antibody produced in mouse clone 7F2D7, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB3500471 Monoclonal Anti-EndoG antibody produced in mouse clone 7F2G10, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004435 Rosetta Predictions human pricing
NM_001034938 Rosetta Predictions rat pricing
NM_007931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059686 predicted 801
2 SASI_Hs01_00059687 predicted 630
3 SASI_Hs01_00059688 predicted 723
4 SASI_Hs02_00337607 predicted 646
5 SASI_Hs01_00059689 predicted 652
6 SASI_Hs01_00059690 predicted 800
7 SASI_Hs01_00059691 predicted 731
8 SASI_Hs01_00059692 predicted 896
9 SASI_Hs01_00059693 predicted 729
10 SASI_Hs01_00059694 predicted 689
11 SASI_Hs01_00059695 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113931 predicted 623
2 SASI_Rn02_00204121 predicted 529
3 SASI_Rn01_00113932 predicted 534
4 SASI_Rn01_00113933 predicted 559
5 SASI_Rn01_00113934 predicted 686
6 SASI_Rn01_00113936 predicted 432
7 SASI_Rn01_00113937 predicted 487
8 SASI_Rn01_00113938 predicted 552
9 SASI_Rn01_00113940 predicted 686
10 SASI_Rn02_00204122 predicted 640
11 SASI_Rn01_00113935 predicted 358
12 SASI_Rn01_00113939 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177568 predicted 760
2 SASI_Mm01_00177569 predicted 565
3 SASI_Mm01_00177570 predicted 769
4 SASI_Mm01_00177571 predicted 656
5 SASI_Mm01_00177572 predicted 442
6 SASI_Mm01_00177573 predicted 514
7 SASI_Mm01_00177574 predicted 506
8 SASI_Mm01_00177575 predicted 596
9 SASI_Mm01_00177576 predicted 366
10 SASI_Mm01_00177577 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007931
VALIDATED
ENDOG MISSION shRNA Bacterial Glycerol Stock
endonuclease G
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-591s1c1
Sequence:CCGGCCGCAGCTTGACGCGAACTTACTCGAGTAAGTTCGCGTCAAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-510s1c1
Sequence:CCGGCGACACCTTCTACCTGAGCAACTCGAGTTGCTCAGGTAGAAGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-276s1c1
Sequence:CCGGCGAGTCCTACGTGCTTAGCTACTCGAGTAGCTAAGCACGTAGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-156s1c1
Sequence:CCGGCCGAGTGCCATTGTTGCCGGTCTCGAGACCGGCAACAATGGCACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-276s21c1
Sequence:CCGGCGAGTCCTACGTGCTTAGCTACTCGAGTAGCTAAGCACGTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-545s21c1
Sequence:CCGGTGCCACACCTCAACCAGAATGCTCGAGCATTCTGGTTGAGGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-510s21c1
Sequence:CCGGCGACACCTTCTACCTGAGCAACTCGAGTTGCTCAGGTAGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007931.1-591s21c1
Sequence:CCGGCCGCAGCTTGACGCGAACTTACTCGAGTAAGTTCGCGTCAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007931.1-569s21c1
Sequence:CCGGGGAACAACCTTGAGAGGTACACTCGAGTGTACCTCTCAAGGTTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007931
VALIDATED
ENDOG MISSION shRNA shRNA Plasmid DNA
endonuclease G
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-591s1c1
Sequence:CCGGCCGCAGCTTGACGCGAACTTACTCGAGTAAGTTCGCGTCAAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-510s1c1
Sequence:CCGGCGACACCTTCTACCTGAGCAACTCGAGTTGCTCAGGTAGAAGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-276s1c1
Sequence:CCGGCGAGTCCTACGTGCTTAGCTACTCGAGTAGCTAAGCACGTAGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-156s1c1
Sequence:CCGGCCGAGTGCCATTGTTGCCGGTCTCGAGACCGGCAACAATGGCACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-276s21c1
Sequence:CCGGCGAGTCCTACGTGCTTAGCTACTCGAGTAGCTAAGCACGTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-545s21c1
Sequence:CCGGTGCCACACCTCAACCAGAATGCTCGAGCATTCTGGTTGAGGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-510s21c1
Sequence:CCGGCGACACCTTCTACCTGAGCAACTCGAGTTGCTCAGGTAGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007931.1-591s21c1
Sequence:CCGGCCGCAGCTTGACGCGAACTTACTCGAGTAAGTTCGCGTCAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007931.1-569s21c1
Sequence:CCGGGGAACAACCTTGAGAGGTACACTCGAGTGTACCTCTCAAGGTTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007931
VALIDATED
ENDOG MISSION shRNA Lentiviral Transduction Particles
endonuclease G
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-591s1c1
Sequence:CCGGCCGCAGCTTGACGCGAACTTACTCGAGTAAGTTCGCGTCAAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-510s1c1
Sequence:CCGGCGACACCTTCTACCTGAGCAACTCGAGTTGCTCAGGTAGAAGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-276s1c1
Sequence:CCGGCGAGTCCTACGTGCTTAGCTACTCGAGTAGCTAAGCACGTAGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007931.1-156s1c1
Sequence:CCGGCCGAGTGCCATTGTTGCCGGTCTCGAGACCGGCAACAATGGCACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-276s21c1
Sequence:CCGGCGAGTCCTACGTGCTTAGCTACTCGAGTAGCTAAGCACGTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-545s21c1
Sequence:CCGGTGCCACACCTCAACCAGAATGCTCGAGCATTCTGGTTGAGGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007931.1-510s21c1
Sequence:CCGGCGACACCTTCTACCTGAGCAACTCGAGTTGCTCAGGTAGAAGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007931.1-591s21c1
Sequence:CCGGCCGCAGCTTGACGCGAACTTACTCGAGTAAGTTCGCGTCAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007931.1-569s21c1
Sequence:CCGGGGAACAACCTTGAGAGGTACACTCGAGTGTACCTCTCAAGGTTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004435
ENDOG MISSION shRNA Bacterial Glycerol Stock
endonuclease G
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.x-785s1c1
Sequence:CCGGCTGATGGGAAATCCTACGTACTCGAGTACGTAGGATTTCCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-690s1c1
Sequence:CCGGCCTGGAACAACCTGGAGAAATCTCGAGATTTCTCCAGGTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-715s1c1
Sequence:CCGGCCGCAGCTTGACCCGCAGCTACTCGAGTAGCTGCGGGTCAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-541s1c1
Sequence:CCGGCCGTGCCACCAACGCCGACTACTCGAGTAGTCGGCGTTGGTGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-635s1c1
Sequence:CCGGGACACGTTCTACCTGAGCAAACTCGAGTTTGCTCAGGTAGAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004435.2-896s21c1
Sequence:CCGGAGCAGGTGGGCAAATTGAGCTCTCGAGAGCTCAATTTGCCCACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004435.2-723s21c1
Sequence:CCGGGAGAAATATAGCCGCAGCTTGCTCGAGCAAGCTGCGGCTATATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004435
ENDOG MISSION shRNA shRNA Plasmid DNA
endonuclease G
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.x-785s1c1
Sequence:CCGGCTGATGGGAAATCCTACGTACTCGAGTACGTAGGATTTCCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-690s1c1
Sequence:CCGGCCTGGAACAACCTGGAGAAATCTCGAGATTTCTCCAGGTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-715s1c1
Sequence:CCGGCCGCAGCTTGACCCGCAGCTACTCGAGTAGCTGCGGGTCAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-541s1c1
Sequence:CCGGCCGTGCCACCAACGCCGACTACTCGAGTAGTCGGCGTTGGTGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-635s1c1
Sequence:CCGGGACACGTTCTACCTGAGCAAACTCGAGTTTGCTCAGGTAGAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004435.2-896s21c1
Sequence:CCGGAGCAGGTGGGCAAATTGAGCTCTCGAGAGCTCAATTTGCCCACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004435.2-723s21c1
Sequence:CCGGGAGAAATATAGCCGCAGCTTGCTCGAGCAAGCTGCGGCTATATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004435
ENDOG MISSION shRNA Lentiviral Transduction Particles
endonuclease G
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.x-785s1c1
Sequence:CCGGCTGATGGGAAATCCTACGTACTCGAGTACGTAGGATTTCCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-690s1c1
Sequence:CCGGCCTGGAACAACCTGGAGAAATCTCGAGATTTCTCCAGGTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-715s1c1
Sequence:CCGGCCGCAGCTTGACCCGCAGCTACTCGAGTAGCTGCGGGTCAAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-541s1c1
Sequence:CCGGCCGTGCCACCAACGCCGACTACTCGAGTAGTCGGCGTTGGTGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004435.1-635s1c1
Sequence:CCGGGACACGTTCTACCTGAGCAAACTCGAGTTTGCTCAGGTAGAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004435.2-896s21c1
Sequence:CCGGAGCAGGTGGGCAAATTGAGCTCTCGAGAGCTCAATTTGCCCACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004435.2-723s21c1
Sequence:CCGGGAGAAATATAGCCGCAGCTTGCTCGAGCAAGCTGCGGCTATATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks