EMAIL THIS PAGE TO A FRIEND

ENDOU

endonuclease, polyU-specific

Synonyms: P11 PP11 PRSS26
UniProtKB ID: P21128, B2RBJ3, B3KQS7, B7Z6E1, Q2NKJ4
Gene ID:
Human(8909) Summary: This gene encodes a protein with protease activity and is expressed in the placenta. The protein may be useful as a tumor marker. Multiple alternatively spliced transcript variants have been found for this protein. [provided by RefSeq, Feb 2010]
Mouse(19011) endonuclease, polyU-specific
Rat(680317) endonuclease, poly(U)-specific
chicken(100858035) endonuclease, polyU-specific
domestic cat(101084802) endonuclease, polyU-specific
Horse(100056519) endonuclease, polyU-specific
cow(525399) endonuclease, polyU-specific
dog(609443) endonuclease, polyU-specific
naked mole-rat(101715062) endonuclease, polyU-specific
domestic guinea pig(100736045) endonuclease, polyU-specific
sheep(101110045) endonuclease, polyU-specific
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006025 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006025 Rosetta Predictions human pricing
XM_001056619 Rosetta Predictions rat pricing
NM_008902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340754 predicted 503
2 SASI_Hs01_00126386 predicted 206
3 SASI_Hs01_00126387 predicted 1082
4 SASI_Hs01_00126388 predicted 1159
5 SASI_Hs02_00340755 predicted 1236
6 SASI_Hs01_00126389 predicted 1182
7 SASI_Hs01_00126392 predicted 908
8 SASI_Hs01_00126393 predicted 578
9 SASI_Hs02_00340756 predicted 830
10 SASI_Hs02_00340757 predicted 1194
11 SASI_Hs01_00126384 predicted 824
12 SASI_Hs01_00126385 predicted 1108
13 SASI_Hs01_00126390 predicted 638
14 SASI_Hs01_00126391 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283836 predicted 1300
2 SASI_Rn02_00283837 predicted 1241
3 SASI_Rn02_00283838 predicted 1176
4 SASI_Rn02_00283839 predicted 1168
5 SASI_Rn02_00283840 predicted 1134
6 SASI_Rn02_00283841 predicted 1200
7 SASI_Rn02_00283842 predicted 1237
8 SASI_Rn02_00283843 predicted 1228
9 SASI_Rn02_00283844 predicted 1250
10 SASI_Rn02_00283845 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163807 predicted 1298
2 SASI_Mm01_00163808 predicted 1016
3 SASI_Mm01_00163809 predicted 841
4 SASI_Mm01_00163810 predicted 855
5 SASI_Mm01_00163811 predicted 725
6 SASI_Mm01_00163812 predicted 890
7 SASI_Mm01_00163814 predicted 1310
8 SASI_Mm01_00163815 predicted 727
9 SASI_Mm02_00314919 predicted 1269
10 SASI_Mm02_00314920 predicted 835
11 SASI_Mm01_00163813 predicted 852
12 SASI_Mm01_00163816 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008902
ENDOU MISSION shRNA Bacterial Glycerol Stock
endonuclease, polyU-specific
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-906s21c1
Sequence:CCGGACAAGAGTTTGTGGACGATTTCTCGAGAAATCGTCCACAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008902.2-2216s21c1
Sequence:CCGGTTATCCAGCTGCCGTAGTTTGCTCGAGCAAACTACGGCAGCTGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-1306s21c1
Sequence:CCGGGATAAGACCACCTACGGAAATCTCGAGATTTCCGTAGGTGGTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.2-907s1c1
Sequence:CCGGCAAGAGTTTGTGGACGATTTGCTCGAGCAAATCGTCCACAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.2-1306s1c1
Sequence:CCGGGATAAGACCACCTACGGAAATCTCGAGATTTCCGTAGGTGGTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-265s21c1
Sequence:CCGGTGGGATGGGATGTGCGAATACCTCGAGGTATTCGCACATCCCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-734s21c1
Sequence:CCGGATGCAGCCTTTATCAACTTACCTCGAGGTAAGTTGATAAAGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.1-726s1c1
Sequence:CCGGGCCTACCTATGCAGCCTTTATCTCGAGATAAAGGCTGCATAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.1-850s1c1
Sequence:CCGGGCTGTCATGAAGGAACTCTATCTCGAGATAGAGTTCCTTCATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201377    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008902.1-2223s1c1
Sequence:CCGGGCTGCCGTAGTTTGAAACATTCTCGAGAATGTTTCAAACTACGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008902
ENDOU MISSION shRNA shRNA Plasmid DNA
endonuclease, polyU-specific
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-906s21c1
Sequence:CCGGACAAGAGTTTGTGGACGATTTCTCGAGAAATCGTCCACAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008902.2-2216s21c1
Sequence:CCGGTTATCCAGCTGCCGTAGTTTGCTCGAGCAAACTACGGCAGCTGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-1306s21c1
Sequence:CCGGGATAAGACCACCTACGGAAATCTCGAGATTTCCGTAGGTGGTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.2-907s1c1
Sequence:CCGGCAAGAGTTTGTGGACGATTTGCTCGAGCAAATCGTCCACAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.2-1306s1c1
Sequence:CCGGGATAAGACCACCTACGGAAATCTCGAGATTTCCGTAGGTGGTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-265s21c1
Sequence:CCGGTGGGATGGGATGTGCGAATACCTCGAGGTATTCGCACATCCCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-734s21c1
Sequence:CCGGATGCAGCCTTTATCAACTTACCTCGAGGTAAGTTGATAAAGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.1-726s1c1
Sequence:CCGGGCCTACCTATGCAGCCTTTATCTCGAGATAAAGGCTGCATAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.1-850s1c1
Sequence:CCGGGCTGTCATGAAGGAACTCTATCTCGAGATAGAGTTCCTTCATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201377    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008902.1-2223s1c1
Sequence:CCGGGCTGCCGTAGTTTGAAACATTCTCGAGAATGTTTCAAACTACGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008902
ENDOU MISSION shRNA Lentiviral Transduction Particles
endonuclease, polyU-specific
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-906s21c1
Sequence:CCGGACAAGAGTTTGTGGACGATTTCTCGAGAAATCGTCCACAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008902.2-2216s21c1
Sequence:CCGGTTATCCAGCTGCCGTAGTTTGCTCGAGCAAACTACGGCAGCTGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-1306s21c1
Sequence:CCGGGATAAGACCACCTACGGAAATCTCGAGATTTCCGTAGGTGGTCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.2-907s1c1
Sequence:CCGGCAAGAGTTTGTGGACGATTTGCTCGAGCAAATCGTCCACAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.2-1306s1c1
Sequence:CCGGGATAAGACCACCTACGGAAATCTCGAGATTTCCGTAGGTGGTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-265s21c1
Sequence:CCGGTGGGATGGGATGTGCGAATACCTCGAGGTATTCGCACATCCCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008902.2-734s21c1
Sequence:CCGGATGCAGCCTTTATCAACTTACCTCGAGGTAAGTTGATAAAGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.1-726s1c1
Sequence:CCGGGCCTACCTATGCAGCCTTTATCTCGAGATAAAGGCTGCATAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008902.1-850s1c1
Sequence:CCGGGCTGTCATGAAGGAACTCTATCTCGAGATAGAGTTCCTTCATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201377    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008902.1-2223s1c1
Sequence:CCGGGCTGCCGTAGTTTGAAACATTCTCGAGAATGTTTCAAACTACGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006025
ENDOU MISSION shRNA Bacterial Glycerol Stock
endonuclease, polyU-specific
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006025.2-1975s1c1
Sequence:CCGGGCTCAGTATCTGCAACAAGAACTCGAGTTCTTGTTGCAGATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-912s1c1
Sequence:CCGGGCAAGGTTACTGGCTTCCATACTCGAGTATGGAAGCCAGTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-580s1c1
Sequence:CCGGGCCACTCTTCACTTATGTCAACTCGAGTTGACATAAGTGAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-1183s1c1
Sequence:CCGGCCGGACATATACCTGGGACAACTCGAGTTGTCCCAGGTATATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-799s1c1
Sequence:CCGGGCAAGAGTTTGTCGATGACTTCTCGAGAAGTCATCGACAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006025
ENDOU MISSION shRNA shRNA Plasmid DNA
endonuclease, polyU-specific
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006025.2-1975s1c1
Sequence:CCGGGCTCAGTATCTGCAACAAGAACTCGAGTTCTTGTTGCAGATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-912s1c1
Sequence:CCGGGCAAGGTTACTGGCTTCCATACTCGAGTATGGAAGCCAGTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-580s1c1
Sequence:CCGGGCCACTCTTCACTTATGTCAACTCGAGTTGACATAAGTGAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-1183s1c1
Sequence:CCGGCCGGACATATACCTGGGACAACTCGAGTTGTCCCAGGTATATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-799s1c1
Sequence:CCGGGCAAGAGTTTGTCGATGACTTCTCGAGAAGTCATCGACAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006025
ENDOU MISSION shRNA Lentiviral Transduction Particles
endonuclease, polyU-specific
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006025.2-1975s1c1
Sequence:CCGGGCTCAGTATCTGCAACAAGAACTCGAGTTCTTGTTGCAGATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-912s1c1
Sequence:CCGGGCAAGGTTACTGGCTTCCATACTCGAGTATGGAAGCCAGTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-580s1c1
Sequence:CCGGGCCACTCTTCACTTATGTCAACTCGAGTTGACATAAGTGAAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-1183s1c1
Sequence:CCGGCCGGACATATACCTGGGACAACTCGAGTTGTCCCAGGTATATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006025.2-799s1c1
Sequence:CCGGGCAAGAGTTTGTCGATGACTTCTCGAGAAGTCATCGACAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks