EMAIL THIS PAGE TO A FRIEND

ENDOV

endonuclease V

64 Gene Product Result for
UniProtKB ID: Q8N8Q3, Q6P2G2, Q86X99, Q8NAK0
Gene ID:
Mouse(338371) endonuclease V
Rat(498029) endonuclease V
sheep(101119998) endonuclease V
naked mole-rat(101723539) endonuclease V
chicken(422079) endonuclease V
cow(526597) endonuclease V
dog(608430) endonuclease V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107134 Anti-Endov antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, human, guinea pig
ELISA, western blot pricing
SAB1400855 Anti-FLJ35220 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002481 MISSION® esiRNA esiRNA targeting mouse A730011L01Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173627 Rosetta Predictions human pricing
XM_573230 Rosetta Predictions rat pricing
XR_005461 Rosetta Predictions rat pricing
XR_009608 Rosetta Predictions rat pricing
NM_177394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186988 predicted 242
2 SASI_Hs01_00186989 predicted 561
3 SASI_Hs01_00186990 predicted 217
4 SASI_Hs01_00186991 predicted 198
5 SASI_Hs01_00186992 predicted 199
6 SASI_Hs01_00186993 predicted 563
7 SASI_Hs01_00186994 predicted 454
8 SASI_Hs02_00368505 predicted 548
9 SASI_Hs01_00186987 predicted 212
10 SASI_Hs01_00186995 predicted 169
11 SASI_Hs01_00186996 predicted 60
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147104 predicted 989
2 SASI_Rn01_00147105 predicted 680
3 SASI_Rn01_00147106 predicted 1053
4 SASI_Rn01_00147107 predicted 635
5 SASI_Rn01_00147108 predicted 1070
6 SASI_Rn01_00147109 predicted 1041
7 SASI_Rn01_00147110 predicted 732
8 SASI_Rn01_00147111 predicted 844
9 SASI_Rn01_00147112 predicted 1035
10 SASI_Rn01_00147113 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409386 predicted 651
2 SASI_Rn02_00409387 predicted 654
3 SASI_Rn02_00409388 predicted 744
4 SASI_Rn02_00409389 predicted 710
5 SASI_Rn02_00409390 predicted 820
6 SASI_Rn02_00409391 predicted 239
7 SASI_Rn02_00409392 predicted 411
8 SASI_Rn02_00409393 predicted 738
9 SASI_Rn02_00409394 predicted 510
10 SASI_Rn02_00409395 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420271 predicted 652
2 SASI_Rn02_00420272 predicted 646
3 SASI_Rn02_00420273 predicted 736
4 SASI_Rn02_00420274 predicted 706
5 SASI_Rn02_00420275 predicted 817
6 SASI_Rn02_00420276 predicted 241
7 SASI_Rn02_00420277 predicted 413
8 SASI_Rn02_00420278 predicted 742
9 SASI_Rn02_00420279 predicted 515
10 SASI_Rn02_00420280 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089546 predicted 1376
2 SASI_Mm01_00089547 predicted 1419
3 SASI_Mm02_00347593 predicted 1192
4 SASI_Mm01_00089549 predicted 1382
5 SASI_Mm01_00089550 predicted 387
6 SASI_Mm02_00347594 predicted 1330
7 SASI_Mm01_00089551 predicted 1123
8 SASI_Mm01_00089552 predicted 1424
9 SASI_Mm01_00089553 predicted 1107
10 SASI_Mm01_00089555 predicted 1471
11 SASI_Mm01_00089548 predicted 653
12 SASI_Mm01_00089554 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173627
VALIDATED
ENDOV MISSION shRNA Bacterial Glycerol Stock
endonuclease V
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173627.2-855s1c1
Sequence:CCGGGAGAGTCCTCAGCACTTTGTTCTCGAGAACAAAGTGCTGAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173627.2-245s1c1
Sequence:CCGGCCTGAGCTCGAGGTGGTGTATCTCGAGATACACCACCTCGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173627.2-444s1c1
Sequence:CCGGCCTGCCACCTTGGCGTCCTTACTCGAGTAAGGACGCCAAGGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_173627.2-179s1c1
Sequence:CCGGGTTGACGTGTCCTTCGTGAAACTCGAGTTTCACGAAGGACACGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173627.3-565s21c1
Sequence:CCGGAGGAGACTCATTCCCTCTGCTCTCGAGAGCAGAGGGAATGAGTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173627.3-391s21c1
Sequence:CCGGGGTCCTTCTTGTGGATGGAAACTCGAGTTTCCATCCACAAGAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173627
VALIDATED
ENDOV MISSION shRNA shRNA Plasmid DNA
endonuclease V
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173627.2-855s1c1
Sequence:CCGGGAGAGTCCTCAGCACTTTGTTCTCGAGAACAAAGTGCTGAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173627.2-245s1c1
Sequence:CCGGCCTGAGCTCGAGGTGGTGTATCTCGAGATACACCACCTCGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173627.2-444s1c1
Sequence:CCGGCCTGCCACCTTGGCGTCCTTACTCGAGTAAGGACGCCAAGGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_173627.2-179s1c1
Sequence:CCGGGTTGACGTGTCCTTCGTGAAACTCGAGTTTCACGAAGGACACGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173627.3-565s21c1
Sequence:CCGGAGGAGACTCATTCCCTCTGCTCTCGAGAGCAGAGGGAATGAGTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173627.3-391s21c1
Sequence:CCGGGGTCCTTCTTGTGGATGGAAACTCGAGTTTCCATCCACAAGAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173627
VALIDATED
ENDOV MISSION shRNA Lentiviral Transduction Particles
endonuclease V
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173627.2-855s1c1
Sequence:CCGGGAGAGTCCTCAGCACTTTGTTCTCGAGAACAAAGTGCTGAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173627.2-245s1c1
Sequence:CCGGCCTGAGCTCGAGGTGGTGTATCTCGAGATACACCACCTCGAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173627.2-444s1c1
Sequence:CCGGCCTGCCACCTTGGCGTCCTTACTCGAGTAAGGACGCCAAGGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_173627.2-179s1c1
Sequence:CCGGGTTGACGTGTCCTTCGTGAAACTCGAGTTTCACGAAGGACACGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173627.3-565s21c1
Sequence:CCGGAGGAGACTCATTCCCTCTGCTCTCGAGAGCAGAGGGAATGAGTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173627.3-391s21c1
Sequence:CCGGGGTCCTTCTTGTGGATGGAAACTCGAGTTTCCATCCACAAGAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177394
ENDOV MISSION shRNA Bacterial Glycerol Stock
endonuclease V
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177394.2-2008s21c1
Sequence:CCGGTGTGATACCCAGGCCCATTTACTCGAGTAAATGGGCCTGGGTATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-393s21c1
Sequence:CCGGGTCGTTCTTGTGGATGGAAACCTCGAGGTTTCCATCCACAAGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-866s21c1
Sequence:CCGGAGGAGCACTTGCAGATCAAGGCTCGAGCCTTGATCTGCAAGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-825s21c1
Sequence:CCGGCAGAAAGAGCAGAGGCCAAATCTCGAGATTTGGCCTCTGCTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-718s21c1
Sequence:CCGGTCCGGATCCCAGAACCTATACCTCGAGGTATAGGTTCTGGGATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177394
ENDOV MISSION shRNA shRNA Plasmid DNA
endonuclease V
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177394.2-2008s21c1
Sequence:CCGGTGTGATACCCAGGCCCATTTACTCGAGTAAATGGGCCTGGGTATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-393s21c1
Sequence:CCGGGTCGTTCTTGTGGATGGAAACCTCGAGGTTTCCATCCACAAGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-866s21c1
Sequence:CCGGAGGAGCACTTGCAGATCAAGGCTCGAGCCTTGATCTGCAAGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-825s21c1
Sequence:CCGGCAGAAAGAGCAGAGGCCAAATCTCGAGATTTGGCCTCTGCTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-718s21c1
Sequence:CCGGTCCGGATCCCAGAACCTATACCTCGAGGTATAGGTTCTGGGATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177394
ENDOV MISSION shRNA Lentiviral Transduction Particles
endonuclease V
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177394.2-2008s21c1
Sequence:CCGGTGTGATACCCAGGCCCATTTACTCGAGTAAATGGGCCTGGGTATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-393s21c1
Sequence:CCGGGTCGTTCTTGTGGATGGAAACCTCGAGGTTTCCATCCACAAGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-866s21c1
Sequence:CCGGAGGAGCACTTGCAGATCAAGGCTCGAGCCTTGATCTGCAAGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-825s21c1
Sequence:CCGGCAGAAAGAGCAGAGGCCAAATCTCGAGATTTGGCCTCTGCTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177394.2-718s21c1
Sequence:CCGGTCCGGATCCCAGAACCTATACCTCGAGGTATAGGTTCTGGGATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks