EMAIL THIS PAGE TO A FRIEND

ENG

endoglin

87 Gene Product Result for
Synonyms: END HHT1 ORW1
UniProtKB ID: P17813, Q14248, Q14926, Q5T9C0
Gene ID:
Human(2022) Summary: This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Mouse(13805) endoglin
Rat(497010) endoglin
chicken(771557) endoglin
cow(615844) endoglin
Horse(100070421) endoglin
dog(609166) endoglin
sheep(101123539) endoglin
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306487 ANTI-CD105 (CENTER E395) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
GW22756 Anti-Endoglin antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
E7534 Anti-Endoglin antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV33068 Anti-ENG (AB1) antibody produced in rabbit IgG fraction of antiserum human, guinea pig, mouse
immunohistochemistry, western blot pricing
AV33069 Anti-ENG (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, pig, rat, mouse, human
immunohistochemistry, western blot pricing
HPA011862 Anti-ENG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA067440 Anti-ENG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4700258 Monoclonal Anti-CD105 antibody produced in mouse clone MEM-226, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700262 Monoclonal Anti-CD105 antibody produced in mouse clone MEM-229, purified immunoglobulin, buffered aqueous solution pig, human
flow cytometry pricing
SAB4700259 Monoclonal Anti-CD105-APC antibody produced in mouse clone MEM-226, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700260 Monoclonal Anti-CD105-FITC antibody produced in mouse clone MEM-226, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700263 Monoclonal Anti-CD105-FITC antibody produced in mouse clone MEM-229, purified immunoglobulin, buffered aqueous solution pig, human
flow cytometry pricing
SAB4700261 Monoclonal Anti-CD105-PE antibody produced in mouse clone MEM-226, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700264 Monoclonal Anti-CD105-PE antibody produced in mouse clone MEM-229, purified immunoglobulin, buffered aqueous solution human, pig
flow cytometry pricing
WH0002022M1 Monoclonal Anti-ENG antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing
AMAB90925 Monoclonal Anti-ENG antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1912, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000118 Rosetta Predictions human pricing
NM_001114753 Rosetta Predictions human pricing
NM_001010968 Rosetta Predictions rat pricing
NM_007932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043570 predicted 1677
2 SASI_Hs01_00043571 predicted 1668
3 SASI_Hs01_00043572 predicted 483
4 SASI_Hs01_00043573 predicted 1469
5 SASI_Hs01_00043574 predicted 1524
6 SASI_Hs01_00043575 predicted 1518
7 SASI_Hs01_00043577 predicted 2015
8 SASI_Hs01_00043578 predicted 1235
9 SASI_Hs01_00043579 predicted 466
10 SASI_Hs02_00301904 predicted 1611
11 SASI_Hs01_00043576 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326814 predicted 1676
2 SASI_Hs02_00326815 predicted 1669
3 SASI_Hs02_00326816 predicted 480
4 SASI_Hs02_00326817 predicted 1467
5 SASI_Hs02_00326818 predicted 1525
6 SASI_Hs02_00326819 predicted 1515
7 SASI_Hs02_00326820 predicted 2016
8 SASI_Hs02_00326821 predicted 1235
9 SASI_Hs02_00326822 predicted 473
10 SASI_Hs02_00326823 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037508 predicted 1541
2 SASI_Rn01_00037510 predicted 1717
3 SASI_Rn01_00037511 predicted 993
4 SASI_Rn02_00199841 predicted 360
5 SASI_Rn01_00037512 predicted 1374
6 SASI_Rn01_00037513 predicted 1564
7 SASI_Rn01_00037514 predicted 1187
8 SASI_Rn01_00037515 predicted 1357
9 SASI_Rn01_00037516 predicted 1105
10 SASI_Rn01_00037517 predicted 1527
11 SASI_Rn01_00037509 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037083 predicted 1635
2 SASI_Mm01_00037084 predicted 422
3 SASI_Mm01_00037085 predicted 1519
4 SASI_Mm01_00037086 predicted 1181
5 SASI_Mm01_00037087 predicted 436
6 SASI_Mm01_00037088 predicted 1281
7 SASI_Mm01_00037089 predicted 1124
8 SASI_Mm01_00037090 predicted 896
9 SASI_Mm02_00312767 predicted 604
10 SASI_Mm01_00037092 predicted 1195
11 SASI_Mm01_00037091 predicted 1873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000118
VALIDATED
ENG MISSION shRNA Bacterial Glycerol Stock
endoglin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-481s21c1
Sequence:CCGGGTCTTGCAGAAACAGTCCATTCTCGAGAATGGACTGTTTCTGCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-532s21c1
Sequence:CCGGGCGAGGTGACATATACCACTACTCGAGTAGTGGTATATGTCACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000118.2-2809s21c1
Sequence:CCGGCCCTGTCATTTGAACCTGGATCTCGAGATCCAGGTTCAAATGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-1655s21c1
Sequence:CCGGGCAGGTGTCAGCAAGTATGATCTCGAGATCATACTTGCTGACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-418s1c1
Sequence:CCGGGTCTTGCAGAAACAGTCCATTCTCGAGAATGGACTGTTTCTGCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000118.1-1592s1c1
Sequence:CCGGGCAGGTGTCAGCAAGTATGATCTCGAGATCATACTTGCTGACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-1952s1c1
Sequence:CCGGCCACTTCTACACAGTACCCATCTCGAGATGGGTACTGTGTAGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-469s1c1
Sequence:CCGGGCGAGGTGACATATACCACTACTCGAGTAGTGGTATATGTCACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-2745s1c1
Sequence:CCGGCCCTGTCATTTGAACCTGGATCTCGAGATCCAGGTTCAAATGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000118
VALIDATED
ENG MISSION shRNA shRNA Plasmid DNA
endoglin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-481s21c1
Sequence:CCGGGTCTTGCAGAAACAGTCCATTCTCGAGAATGGACTGTTTCTGCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-532s21c1
Sequence:CCGGGCGAGGTGACATATACCACTACTCGAGTAGTGGTATATGTCACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000118.2-2809s21c1
Sequence:CCGGCCCTGTCATTTGAACCTGGATCTCGAGATCCAGGTTCAAATGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-1655s21c1
Sequence:CCGGGCAGGTGTCAGCAAGTATGATCTCGAGATCATACTTGCTGACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-418s1c1
Sequence:CCGGGTCTTGCAGAAACAGTCCATTCTCGAGAATGGACTGTTTCTGCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000118.1-1592s1c1
Sequence:CCGGGCAGGTGTCAGCAAGTATGATCTCGAGATCATACTTGCTGACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-1952s1c1
Sequence:CCGGCCACTTCTACACAGTACCCATCTCGAGATGGGTACTGTGTAGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-469s1c1
Sequence:CCGGGCGAGGTGACATATACCACTACTCGAGTAGTGGTATATGTCACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-2745s1c1
Sequence:CCGGCCCTGTCATTTGAACCTGGATCTCGAGATCCAGGTTCAAATGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000118
VALIDATED
ENG MISSION shRNA Lentiviral Transduction Particles
endoglin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-481s21c1
Sequence:CCGGGTCTTGCAGAAACAGTCCATTCTCGAGAATGGACTGTTTCTGCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-532s21c1
Sequence:CCGGGCGAGGTGACATATACCACTACTCGAGTAGTGGTATATGTCACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000118.2-2809s21c1
Sequence:CCGGCCCTGTCATTTGAACCTGGATCTCGAGATCCAGGTTCAAATGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000118.2-1655s21c1
Sequence:CCGGGCAGGTGTCAGCAAGTATGATCTCGAGATCATACTTGCTGACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-418s1c1
Sequence:CCGGGTCTTGCAGAAACAGTCCATTCTCGAGAATGGACTGTTTCTGCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000118.1-1592s1c1
Sequence:CCGGGCAGGTGTCAGCAAGTATGATCTCGAGATCATACTTGCTGACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-1952s1c1
Sequence:CCGGCCACTTCTACACAGTACCCATCTCGAGATGGGTACTGTGTAGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-469s1c1
Sequence:CCGGGCGAGGTGACATATACCACTACTCGAGTAGTGGTATATGTCACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000118.1-2745s1c1
Sequence:CCGGCCCTGTCATTTGAACCTGGATCTCGAGATCCAGGTTCAAATGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007932
VALIDATED
ENG MISSION shRNA Bacterial Glycerol Stock
endoglin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-2589s1c1
Sequence:CCGGCCATGCTGCTTAGAAGCCTAACTCGAGTTAGGCTTCTAAGCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-395s1c1
Sequence:CCGGCCCTGCTGTTTGTCATCTATACTCGAGTATAGATGACAAACAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1750s1c1
Sequence:CCGGGCATCCAACACCATCGAACTACTCGAGTAGTTCGATGGTGTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1185s1c1
Sequence:CCGGAGGTGAATACTCCGTCAAGATCTCGAGATCTTGACGGAGTATTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1073s1c1
Sequence:CCGGCCGTAATGATGGAACTGAGTTCTCGAGAACTCAGTTCCATCATTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007932
VALIDATED
ENG MISSION shRNA shRNA Plasmid DNA
endoglin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-2589s1c1
Sequence:CCGGCCATGCTGCTTAGAAGCCTAACTCGAGTTAGGCTTCTAAGCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-395s1c1
Sequence:CCGGCCCTGCTGTTTGTCATCTATACTCGAGTATAGATGACAAACAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1750s1c1
Sequence:CCGGGCATCCAACACCATCGAACTACTCGAGTAGTTCGATGGTGTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1185s1c1
Sequence:CCGGAGGTGAATACTCCGTCAAGATCTCGAGATCTTGACGGAGTATTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1073s1c1
Sequence:CCGGCCGTAATGATGGAACTGAGTTCTCGAGAACTCAGTTCCATCATTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007932
VALIDATED
ENG MISSION shRNA Lentiviral Transduction Particles
endoglin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-2589s1c1
Sequence:CCGGCCATGCTGCTTAGAAGCCTAACTCGAGTTAGGCTTCTAAGCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-395s1c1
Sequence:CCGGCCCTGCTGTTTGTCATCTATACTCGAGTATAGATGACAAACAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1750s1c1
Sequence:CCGGGCATCCAACACCATCGAACTACTCGAGTAGTTCGATGGTGTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1185s1c1
Sequence:CCGGAGGTGAATACTCCGTCAAGATCTCGAGATCTTGACGGAGTATTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007932.1-1073s1c1
Sequence:CCGGCCGTAATGATGGAACTGAGTTCTCGAGAACTCAGTTCCATCATTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)