EMAIL THIS PAGE TO A FRIEND

ENGASE

endo-beta-N-acetylglucosaminidase

UniProtKB ID: Q8NFI3, Q659F0, Q8TB86, Q9H6U4
Gene ID:
Human(64772) Summary: This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
Mouse(217364) endo-beta-N-acetylglucosaminidase
Rat(303702) endo-beta-N-acetylglucosaminidase
chicken(430102) endo-beta-N-acetylglucosaminidase
domestic cat(101084586) endo-beta-N-acetylglucosaminidase
cow(100847654) endo-beta-N-acetylglucosaminidase
dog(483347) endo-beta-N-acetylglucosaminidase
sheep(101112239) endo-beta-N-acetylglucosaminidase
domestic guinea pig(100732457) endo-beta-N-acetylglucosaminidase
naked mole-rat(101711000) endo-beta-N-acetylglucosaminidase
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042573 Rosetta Predictions human pricing
NM_022759 Rosetta Predictions human pricing
NM_001107070 Rosetta Predictions rat pricing
NM_172573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310598 predicted 372
2 SASI_Hs02_00310599 predicted 1165
3 SASI_Hs02_00310600 predicted 1592
4 SASI_Hs02_00310601 predicted 1032
5 SASI_Hs02_00310602 predicted 1168
6 SASI_Hs02_00310603 predicted 830
7 SASI_Hs02_00310604 predicted 842
8 SASI_Hs02_00310605 predicted 1577
9 SASI_Hs02_00310606 predicted 1475
10 SASI_Hs02_00310607 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081959 predicted 699
2 SASI_Hs01_00081960 predicted 1047
3 SASI_Hs01_00081961 predicted 384
4 SASI_Hs01_00081962 predicted 833
5 SASI_Hs01_00081963 predicted 450
6 SASI_Hs01_00081964 predicted 840
7 SASI_Hs01_00081965 predicted 1152
8 SASI_Hs01_00081966 predicted 479
9 SASI_Hs01_00081967 predicted 821
10 SASI_Hs01_00081968 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225196 predicted 357
2 SASI_Rn02_00225197 predicted 2454
3 SASI_Rn02_00225198 predicted 331
4 SASI_Rn02_00225199 predicted 1221
5 SASI_Rn02_00225200 predicted 1815
6 SASI_Rn02_00225201 predicted 267
7 SASI_Rn02_00225202 predicted 570
8 SASI_Rn02_00225203 predicted 1697
9 SASI_Rn02_00225204 predicted 935
10 SASI_Rn02_00225205 predicted 1613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023102 predicted 228
2 SASI_Mm01_00023103 predicted 1569
3 SASI_Mm01_00023104 predicted 205
4 SASI_Mm01_00023105 predicted 1692
5 SASI_Mm01_00023106 predicted 1093
6 SASI_Mm01_00023107 predicted 1513
7 SASI_Mm01_00023108 predicted 658
8 SASI_Mm01_00023109 predicted 447
9 SASI_Mm01_00023110 predicted 410
10 SASI_Mm01_00023111 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172573
ENGASE MISSION shRNA Bacterial Glycerol Stock
endo-beta-N-acetylglucosaminidase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-1861s1c1
Sequence:CCGGGAATGTCACCATTTCTCAGATCTCGAGATCTGAGAAATGGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-670s1c1
Sequence:CCGGGATTGCTCAGTTCTTTCGTTTCTCGAGAAACGAAAGAACTGAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-456s21c1
Sequence:CCGGTTCTACCACTGGCAGTATATCCTCGAGGATATACTGCCAGTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172573.2-3730s21c1
Sequence:CCGGAGTCTGGTGAGCAAGCAATTACTCGAGTAATTGCTTGCTCACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-899s1c1
Sequence:CCGGGGCTTCTTTACCAACTATAACCTCGAGGTTATAGTTGGTAAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-896s21c1
Sequence:CCGGTGGCTTCTTTACCAACTATAACTCGAGTTATAGTTGGTAAAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-1486s21c1
Sequence:CCGGTGTCCATGGTGTACAAGTTTGCTCGAGCAAACTTGTACACCATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-1694s21c1
Sequence:CCGGTCAACGCTGCTATGAGGTAAACTCGAGTTTACCTCATAGCAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172573
ENGASE MISSION shRNA shRNA Plasmid DNA
endo-beta-N-acetylglucosaminidase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-1861s1c1
Sequence:CCGGGAATGTCACCATTTCTCAGATCTCGAGATCTGAGAAATGGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-670s1c1
Sequence:CCGGGATTGCTCAGTTCTTTCGTTTCTCGAGAAACGAAAGAACTGAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-456s21c1
Sequence:CCGGTTCTACCACTGGCAGTATATCCTCGAGGATATACTGCCAGTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172573.2-3730s21c1
Sequence:CCGGAGTCTGGTGAGCAAGCAATTACTCGAGTAATTGCTTGCTCACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-899s1c1
Sequence:CCGGGGCTTCTTTACCAACTATAACCTCGAGGTTATAGTTGGTAAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-896s21c1
Sequence:CCGGTGGCTTCTTTACCAACTATAACTCGAGTTATAGTTGGTAAAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-1486s21c1
Sequence:CCGGTGTCCATGGTGTACAAGTTTGCTCGAGCAAACTTGTACACCATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-1694s21c1
Sequence:CCGGTCAACGCTGCTATGAGGTAAACTCGAGTTTACCTCATAGCAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172573
ENGASE MISSION shRNA Lentiviral Transduction Particles
endo-beta-N-acetylglucosaminidase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-1861s1c1
Sequence:CCGGGAATGTCACCATTTCTCAGATCTCGAGATCTGAGAAATGGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-670s1c1
Sequence:CCGGGATTGCTCAGTTCTTTCGTTTCTCGAGAAACGAAAGAACTGAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-456s21c1
Sequence:CCGGTTCTACCACTGGCAGTATATCCTCGAGGATATACTGCCAGTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172573.2-3730s21c1
Sequence:CCGGAGTCTGGTGAGCAAGCAATTACTCGAGTAATTGCTTGCTCACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172573.1-899s1c1
Sequence:CCGGGGCTTCTTTACCAACTATAACCTCGAGGTTATAGTTGGTAAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-896s21c1
Sequence:CCGGTGGCTTCTTTACCAACTATAACTCGAGTTATAGTTGGTAAAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-1486s21c1
Sequence:CCGGTGTCCATGGTGTACAAGTTTGCTCGAGCAAACTTGTACACCATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172573.2-1694s21c1
Sequence:CCGGTCAACGCTGCTATGAGGTAAACTCGAGTTTACCTCATAGCAGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022759
ENGASE MISSION shRNA Bacterial Glycerol Stock
endo-beta-N-acetylglucosaminidase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022759.1-911s1c1
Sequence:CCGGCACTAACTATAACTGGCGGGACTCGAGTCCCGCCAGTTATAGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2119s1c1
Sequence:CCGGGAAGTGAGTTTGCCAAGGATACTCGAGTATCCTTGGCAAACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2544s1c1
Sequence:CCGGGCAGGCAATTAATTAGGAGTACTCGAGTACTCCTAATTAATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2335s1c1
Sequence:CCGGGCCTTTCTGTCTCATTTGGAACTCGAGTTCCAAATGAGACAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2442s1c1
Sequence:CCGGCCTTCTTTCATGAAGTCTGTTCTCGAGAACAGACTTCATGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022759.1-215s1c1
Sequence:CCGGCCTGCCAGTTAGATATTATGACTCGAGTCATAATATCTAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022759
ENGASE MISSION shRNA shRNA Plasmid DNA
endo-beta-N-acetylglucosaminidase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022759.1-911s1c1
Sequence:CCGGCACTAACTATAACTGGCGGGACTCGAGTCCCGCCAGTTATAGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2119s1c1
Sequence:CCGGGAAGTGAGTTTGCCAAGGATACTCGAGTATCCTTGGCAAACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2544s1c1
Sequence:CCGGGCAGGCAATTAATTAGGAGTACTCGAGTACTCCTAATTAATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2335s1c1
Sequence:CCGGGCCTTTCTGTCTCATTTGGAACTCGAGTTCCAAATGAGACAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2442s1c1
Sequence:CCGGCCTTCTTTCATGAAGTCTGTTCTCGAGAACAGACTTCATGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022759.1-215s1c1
Sequence:CCGGCCTGCCAGTTAGATATTATGACTCGAGTCATAATATCTAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022759
ENGASE MISSION shRNA Lentiviral Transduction Particles
endo-beta-N-acetylglucosaminidase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022759.1-911s1c1
Sequence:CCGGCACTAACTATAACTGGCGGGACTCGAGTCCCGCCAGTTATAGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2119s1c1
Sequence:CCGGGAAGTGAGTTTGCCAAGGATACTCGAGTATCCTTGGCAAACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2544s1c1
Sequence:CCGGGCAGGCAATTAATTAGGAGTACTCGAGTACTCCTAATTAATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2335s1c1
Sequence:CCGGGCCTTTCTGTCTCATTTGGAACTCGAGTTCCAAATGAGACAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022759.1-2442s1c1
Sequence:CCGGCCTTCTTTCATGAAGTCTGTTCTCGAGAACAGACTTCATGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022759.1-215s1c1
Sequence:CCGGCCTGCCAGTTAGATATTATGACTCGAGTCATAATATCTAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042573
VALIDATED
ENGASE MISSION shRNA Bacterial Glycerol Stock
endo-beta-N-acetylglucosaminidase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000236155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042573.1-1487s21c1
Sequence:CCGGTTACCTGTCCATGGTGTATAACTCGAGTTATACACCATGGACAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042573.1-1586s21c1
Sequence:CCGGCTCAGTGTTGAACGCAGAAACCTCGAGGTTTCTGCGTTCAACACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042573.1-901s21c1
Sequence:CCGGACGGCTTCTTCACTAACTATACTCGAGTATAGTTAGTGAAGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042573.1-4298s21c1
Sequence:CCGGTCTGGTGAGCAGGCAATTAATCTCGAGATTAATTGCCTGCTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042573
VALIDATED
ENGASE MISSION shRNA shRNA Plasmid DNA
endo-beta-N-acetylglucosaminidase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000236155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042573.1-1487s21c1
Sequence:CCGGTTACCTGTCCATGGTGTATAACTCGAGTTATACACCATGGACAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042573.1-1586s21c1
Sequence:CCGGCTCAGTGTTGAACGCAGAAACCTCGAGGTTTCTGCGTTCAACACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042573.1-901s21c1
Sequence:CCGGACGGCTTCTTCACTAACTATACTCGAGTATAGTTAGTGAAGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042573.1-4298s21c1
Sequence:CCGGTCTGGTGAGCAGGCAATTAATCTCGAGATTAATTGCCTGCTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042573
VALIDATED
ENGASE MISSION shRNA Lentiviral Transduction Particles
endo-beta-N-acetylglucosaminidase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000236155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042573.1-1487s21c1
Sequence:CCGGTTACCTGTCCATGGTGTATAACTCGAGTTATACACCATGGACAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042573.1-1586s21c1
Sequence:CCGGCTCAGTGTTGAACGCAGAAACCTCGAGGTTTCTGCGTTCAACACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042573.1-901s21c1
Sequence:CCGGACGGCTTCTTCACTAACTATACTCGAGTATAGTTAGTGAAGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042573.1-4298s21c1
Sequence:CCGGTCTGGTGAGCAGGCAATTAATCTCGAGATTAATTGCCTGCTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks