EMAIL THIS PAGE TO A FRIEND

ENHO

energy homeostasis associated

79 Gene Product Result for
Synonyms: C9orf165 UNQ470
UniProtKB ID: Q6UWT2, Q8N666
Gene ID:
Mouse(69638) energy homeostasis associated
chicken(768968) energy homeostasis associated
cow(783487) energy homeostasis associated
Horse(100054090) energy homeostasis associated
dog(100688608) energy homeostasis associated
domestic cat(101083464) energy homeostasis associated
naked mole-rat(101703780) energy homeostasis associated
domestic guinea pig(100725577) energy homeostasis associated
sheep(101121999) energy homeostasis associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_351808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_351808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_351808 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198573 Rosetta Predictions human pricing
NM_027147 Rosetta Predictions mouse pricing
XM_886867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195756 predicted 539
2 SASI_Hs01_00195757 predicted 538
3 SASI_Hs01_00195758 predicted 701
4 SASI_Hs01_00195759 predicted 700
5 SASI_Hs01_00195760 predicted 796
6 SASI_Hs01_00195761 predicted 511
7 SASI_Hs01_00195762 predicted 535
8 SASI_Hs01_00195763 predicted 678
9 SASI_Hs01_00195764 predicted 616
10 SASI_Hs01_00195765 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331647 predicted 922
2 SASI_Mm02_00331648 predicted 671
3 SASI_Mm02_00331649 predicted 821
4 SASI_Mm02_00331650 predicted 642
5 SASI_Mm02_00331651 predicted 589
6 SASI_Mm02_00331652 predicted 570
7 SASI_Mm02_00331653 predicted 968
8 SASI_Mm02_00331654 predicted 657
9 SASI_Mm02_00331655 predicted 828
10 SASI_Mm02_00331656 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227633 predicted 88
2 SASI_Mm01_00227634 predicted 125
3 SASI_Mm01_00227635 predicted 100
4 SASI_Mm01_00227636 predicted 41
5 SASI_Mm01_00227637 predicted 21
6 SASI_Mm01_00227638 predicted 28
7 SASI_Mm01_00227639 predicted 112
8 SASI_Mm01_00227640 predicted 123
9 SASI_Mm01_00227641 predicted 34
10 SASI_Mm01_00227642 predicted 127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027147
ENHO MISSION shRNA Bacterial Glycerol Stock
energy homeostasis associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027147.1-798s21c1
Sequence:CCGGGGAGTCCTGGACCTGAGTATACTCGAGTATACTCAGGTCCAGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-616s21c1
Sequence:CCGGTGCTACTGCTCTGGGTCATTCCTCGAGGAATGACCCAGAGCAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-656s21c1
Sequence:CCGGTCGATCTGCTGACGTCGATTCCTCGAGGAATCGACGTCAGCAGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-577s21c1
Sequence:CCGGTCATCGCCATCGTCTGCAATGCTCGAGCATTGCAGACGATGGCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-679s21c1
Sequence:CCGGTCTCGGAATCCAGTCCCAACTCTCGAGAGTTGGGACTGGATTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027147
ENHO MISSION shRNA shRNA Plasmid DNA
energy homeostasis associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027147.1-798s21c1
Sequence:CCGGGGAGTCCTGGACCTGAGTATACTCGAGTATACTCAGGTCCAGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-616s21c1
Sequence:CCGGTGCTACTGCTCTGGGTCATTCCTCGAGGAATGACCCAGAGCAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-656s21c1
Sequence:CCGGTCGATCTGCTGACGTCGATTCCTCGAGGAATCGACGTCAGCAGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-577s21c1
Sequence:CCGGTCATCGCCATCGTCTGCAATGCTCGAGCATTGCAGACGATGGCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-679s21c1
Sequence:CCGGTCTCGGAATCCAGTCCCAACTCTCGAGAGTTGGGACTGGATTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027147
ENHO MISSION shRNA Lentiviral Transduction Particles
energy homeostasis associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027147.1-798s21c1
Sequence:CCGGGGAGTCCTGGACCTGAGTATACTCGAGTATACTCAGGTCCAGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-616s21c1
Sequence:CCGGTGCTACTGCTCTGGGTCATTCCTCGAGGAATGACCCAGAGCAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-656s21c1
Sequence:CCGGTCGATCTGCTGACGTCGATTCCTCGAGGAATCGACGTCAGCAGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-577s21c1
Sequence:CCGGTCATCGCCATCGTCTGCAATGCTCGAGCATTGCAGACGATGGCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027147.1-679s21c1
Sequence:CCGGTCTCGGAATCCAGTCCCAACTCTCGAGAGTTGGGACTGGATTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_351808
VALIDATED
ENHO MISSION shRNA Bacterial Glycerol Stock
energy homeostasis associated
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-41s1c1
Sequence:CCGGGCTCAGACATTCACTCACTTGCTCGAGCAAGTGAGTGAATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-33s1c1
Sequence:CCGGCAACTATGGCTCAGACATTCACTCGAGTGAATGTCTGAGCCATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-63s1c1
Sequence:CCGGCTATAGTCATATACGAAGCAACTCGAGTTGCTTCGTATATGACTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-81s1c1
Sequence:CCGGCAATGGACAGATGAGTTCAGACTCGAGTCTGAACTCATCTGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:XM_351808.1-27s1c1
Sequence:CCGGGTGGAACAACTATGGCTCAGACTCGAGTCTGAGCCATAGTTGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-46s1c1
Sequence:CCGGGACATTCACTCACTTGCCTATCTCGAGATAGGCAAGTGAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-30s1c1
Sequence:CCGGGAACAACTATGGCTCAGACATCTCGAGATGTCTGAGCCATAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-90s1c1
Sequence:CCGGGATGAGTTCAGATGCAGACATCTCGAGATGTCTGCATCTGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_351808
VALIDATED
ENHO MISSION shRNA shRNA Plasmid DNA
energy homeostasis associated
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-41s1c1
Sequence:CCGGGCTCAGACATTCACTCACTTGCTCGAGCAAGTGAGTGAATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-33s1c1
Sequence:CCGGCAACTATGGCTCAGACATTCACTCGAGTGAATGTCTGAGCCATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-63s1c1
Sequence:CCGGCTATAGTCATATACGAAGCAACTCGAGTTGCTTCGTATATGACTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-81s1c1
Sequence:CCGGCAATGGACAGATGAGTTCAGACTCGAGTCTGAACTCATCTGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:XM_351808.1-27s1c1
Sequence:CCGGGTGGAACAACTATGGCTCAGACTCGAGTCTGAGCCATAGTTGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-46s1c1
Sequence:CCGGGACATTCACTCACTTGCCTATCTCGAGATAGGCAAGTGAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-30s1c1
Sequence:CCGGGAACAACTATGGCTCAGACATCTCGAGATGTCTGAGCCATAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-90s1c1
Sequence:CCGGGATGAGTTCAGATGCAGACATCTCGAGATGTCTGCATCTGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_351808
VALIDATED
ENHO MISSION shRNA Lentiviral Transduction Particles
energy homeostasis associated
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-41s1c1
Sequence:CCGGGCTCAGACATTCACTCACTTGCTCGAGCAAGTGAGTGAATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-33s1c1
Sequence:CCGGCAACTATGGCTCAGACATTCACTCGAGTGAATGTCTGAGCCATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-63s1c1
Sequence:CCGGCTATAGTCATATACGAAGCAACTCGAGTTGCTTCGTATATGACTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-81s1c1
Sequence:CCGGCAATGGACAGATGAGTTCAGACTCGAGTCTGAACTCATCTGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:XM_351808.1-27s1c1
Sequence:CCGGGTGGAACAACTATGGCTCAGACTCGAGTCTGAGCCATAGTTGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-46s1c1
Sequence:CCGGGACATTCACTCACTTGCCTATCTCGAGATAGGCAAGTGAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-30s1c1
Sequence:CCGGGAACAACTATGGCTCAGACATCTCGAGATGTCTGAGCCATAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_351808.1-90s1c1
Sequence:CCGGGATGAGTTCAGATGCAGACATCTCGAGATGTCTGCATCTGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks