EMAIL THIS PAGE TO A FRIEND

ENKD1

enkurin domain containing 1

Synonyms: C16orf48 DAKV6410
UniProtKB ID: Q9H0I2, Q6UWD7
Gene ID:
Mouse(102124) enkurin domain containing 1
Rat(291975) enkurin domain containing 1
sheep(101115148) enkurin domain containing 1
domestic guinea pig(100729925) enkurin domain containing 1
naked mole-rat(101708044) enkurin domain containing 1
domestic cat(101090312) enkurin domain containing 1
cow(524652) enkurin domain containing 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032140 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032140 Rosetta Predictions human pricing
NM_001106180 Rosetta Predictions rat pricing
NM_198299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359368 predicted 1204
2 SASI_Hs01_00082346 predicted 676
3 SASI_Hs01_00082347 predicted 560
4 SASI_Hs01_00082348 predicted 931
5 SASI_Hs01_00082349 predicted 601
6 SASI_Hs01_00082350 predicted 608
7 SASI_Hs01_00082351 predicted 716
8 SASI_Hs02_00359369 predicted 994
9 SASI_Hs01_00082352 predicted 1010
10 SASI_Hs01_00082353 predicted 1117
11 SASI_Hs01_00082354 predicted 883
12 SASI_Hs01_00082355 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216418 predicted 873
2 SASI_Rn02_00216419 predicted 615
3 SASI_Rn02_00216420 predicted 607
4 SASI_Rn02_00216421 predicted 1136
5 SASI_Rn02_00216422 predicted 1132
6 SASI_Rn02_00216423 predicted 986
7 SASI_Rn02_00216424 predicted 329
8 SASI_Rn02_00216425 predicted 1242
9 SASI_Rn02_00216426 predicted 698
10 SASI_Rn02_00216427 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145345 predicted 437
2 SASI_Mm01_00145346 predicted 736
3 SASI_Mm01_00145347 predicted 887
4 SASI_Mm01_00145348 predicted 467
5 SASI_Mm01_00145349 predicted 504
6 SASI_Mm01_00145350 predicted 921
7 SASI_Mm01_00145351 predicted 980
8 SASI_Mm01_00145352 predicted 365
9 SASI_Mm01_00145354 predicted 997
10 SASI_Mm02_00350930 predicted 394
11 SASI_Mm01_00145353 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198299
VALIDATED
ENKD1 MISSION shRNA Bacterial Glycerol Stock
enkurin domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-1044s1c1
Sequence:CCGGCCGACCCAAAGTCTTTGTGAACTCGAGTTCACAAAGACTTTGGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-439s1c1
Sequence:CCGGCGCTCACCCAAGTATGACAATCTCGAGATTGTCATACTTGGGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-321s1c1
Sequence:CCGGGAATCCAAAGGACCATGAGAACTCGAGTTCTCATGGTCCTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-930s21c1
Sequence:CCGGGCTACGTGAGCTAGTACTATTCTCGAGAATAGTACTAGCTCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198299.1-623s21c1
Sequence:CCGGGCCTAGGCGTGGATTTCATTACTCGAGTAATGAAATCCACGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198299.1-440s21c1
Sequence:CCGGGCTCACCCAAGTATGACAATGCTCGAGCATTGTCATACTTGGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-930s1c1
Sequence:CCGGGCTACGTGAGCTAGTACTATTCTCGAGAATAGTACTAGCTCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-1099s21c1
Sequence:CCGGCCAAGAGTAACAGGGAGATATCTCGAGATATCTCCCTGTTACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-999s21c1
Sequence:CCGGGGACCGGAAGTTGGTGCAAATCTCGAGATTTGCACCAACTTCCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198299
VALIDATED
ENKD1 MISSION shRNA shRNA Plasmid DNA
enkurin domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-1044s1c1
Sequence:CCGGCCGACCCAAAGTCTTTGTGAACTCGAGTTCACAAAGACTTTGGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-439s1c1
Sequence:CCGGCGCTCACCCAAGTATGACAATCTCGAGATTGTCATACTTGGGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-321s1c1
Sequence:CCGGGAATCCAAAGGACCATGAGAACTCGAGTTCTCATGGTCCTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-930s21c1
Sequence:CCGGGCTACGTGAGCTAGTACTATTCTCGAGAATAGTACTAGCTCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198299.1-623s21c1
Sequence:CCGGGCCTAGGCGTGGATTTCATTACTCGAGTAATGAAATCCACGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198299.1-440s21c1
Sequence:CCGGGCTCACCCAAGTATGACAATGCTCGAGCATTGTCATACTTGGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-930s1c1
Sequence:CCGGGCTACGTGAGCTAGTACTATTCTCGAGAATAGTACTAGCTCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-1099s21c1
Sequence:CCGGCCAAGAGTAACAGGGAGATATCTCGAGATATCTCCCTGTTACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-999s21c1
Sequence:CCGGGGACCGGAAGTTGGTGCAAATCTCGAGATTTGCACCAACTTCCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198299
VALIDATED
ENKD1 MISSION shRNA Lentiviral Transduction Particles
enkurin domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-1044s1c1
Sequence:CCGGCCGACCCAAAGTCTTTGTGAACTCGAGTTCACAAAGACTTTGGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-439s1c1
Sequence:CCGGCGCTCACCCAAGTATGACAATCTCGAGATTGTCATACTTGGGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-321s1c1
Sequence:CCGGGAATCCAAAGGACCATGAGAACTCGAGTTCTCATGGTCCTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-930s21c1
Sequence:CCGGGCTACGTGAGCTAGTACTATTCTCGAGAATAGTACTAGCTCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198299.1-623s21c1
Sequence:CCGGGCCTAGGCGTGGATTTCATTACTCGAGTAATGAAATCCACGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198299.1-440s21c1
Sequence:CCGGGCTCACCCAAGTATGACAATGCTCGAGCATTGTCATACTTGGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198299.1-930s1c1
Sequence:CCGGGCTACGTGAGCTAGTACTATTCTCGAGAATAGTACTAGCTCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-1099s21c1
Sequence:CCGGCCAAGAGTAACAGGGAGATATCTCGAGATATCTCCCTGTTACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198299.1-999s21c1
Sequence:CCGGGGACCGGAAGTTGGTGCAAATCTCGAGATTTGCACCAACTTCCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032140
ENKD1 MISSION shRNA Bacterial Glycerol Stock
enkurin domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032140.1-878s1c1
Sequence:CCGGGTGGACTTCATTCGTCACAATCTCGAGATTGTGACGAATGAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032140.1-881s1c1
Sequence:CCGGGACTTCATTCGTCACAATGCACTCGAGTGCATTGTGACGAATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032140.1-1442s21c1
Sequence:CCGGCAGTGTCCCTAGAGCACTCTTCTCGAGAAGAGTGCTCTAGGGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-878s21c1
Sequence:CCGGGTGGACTTCATTCGTCACAATCTCGAGATTGTGACGAATGAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1268s21c1
Sequence:CCGGGAGGAGGCCATCAAGATCTTTCTCGAGAAAGATCTTGATGGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1305s21c1
Sequence:CCGGTCGTGAAGATGGACGACTGAGCTCGAGCTCAGTCGTCCATCTTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1006s21c1
Sequence:CCGGGAAGGGCCATGTGCCACATTACTCGAGTAATGTGGCACATGGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032140
ENKD1 MISSION shRNA shRNA Plasmid DNA
enkurin domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032140.1-878s1c1
Sequence:CCGGGTGGACTTCATTCGTCACAATCTCGAGATTGTGACGAATGAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032140.1-881s1c1
Sequence:CCGGGACTTCATTCGTCACAATGCACTCGAGTGCATTGTGACGAATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032140.1-1442s21c1
Sequence:CCGGCAGTGTCCCTAGAGCACTCTTCTCGAGAAGAGTGCTCTAGGGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-878s21c1
Sequence:CCGGGTGGACTTCATTCGTCACAATCTCGAGATTGTGACGAATGAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1268s21c1
Sequence:CCGGGAGGAGGCCATCAAGATCTTTCTCGAGAAAGATCTTGATGGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1305s21c1
Sequence:CCGGTCGTGAAGATGGACGACTGAGCTCGAGCTCAGTCGTCCATCTTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1006s21c1
Sequence:CCGGGAAGGGCCATGTGCCACATTACTCGAGTAATGTGGCACATGGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032140
ENKD1 MISSION shRNA Lentiviral Transduction Particles
enkurin domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032140.1-878s1c1
Sequence:CCGGGTGGACTTCATTCGTCACAATCTCGAGATTGTGACGAATGAAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032140.1-881s1c1
Sequence:CCGGGACTTCATTCGTCACAATGCACTCGAGTGCATTGTGACGAATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032140.1-1442s21c1
Sequence:CCGGCAGTGTCCCTAGAGCACTCTTCTCGAGAAGAGTGCTCTAGGGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-878s21c1
Sequence:CCGGGTGGACTTCATTCGTCACAATCTCGAGATTGTGACGAATGAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1268s21c1
Sequence:CCGGGAGGAGGCCATCAAGATCTTTCTCGAGAAAGATCTTGATGGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1305s21c1
Sequence:CCGGTCGTGAAGATGGACGACTGAGCTCGAGCTCAGTCGTCCATCTTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032140.1-1006s21c1
Sequence:CCGGGAAGGGCCATGTGCCACATTACTCGAGTAATGTGGCACATGGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks