EMAIL THIS PAGE TO A FRIEND

ENKUR

enkurin, TRPC channel interacting protein

68 Gene Product Result for
Synonyms: C10orf63
UniProtKB ID: Q8TC29, A8K8Y0, D3DRV2
Gene ID:
Human(219670) Summary: This gene encodes a protein that interacts with calmodulin and several transient receptor potential canonical cation channel proteins. The encoded protein may function as an adaptor to localize signal transduction machinery to calcium channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(71233) enkurin, TRPC channel interacting protein
Rat(291354) enkurin, TRPC channel interacting protein
Zebrafish(402794) enkurin, TRPC channel interacting protein
chicken(420498) enkurin, TRPC channel interacting protein
cow(516469) enkurin, TRPC channel interacting protein
domestic cat(101081736) enkurin, TRPC channel interacting protein
dog(487104) enkurin, TRPC channel interacting protein
naked mole-rat(101700485) enkurin, TRPC channel interacting protein
domestic guinea pig(100735981) enkurin, TRPC channel interacting protein
sheep(101105676) enkurin, TRPC channel interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145010 Rosetta Predictions human pricing
NM_001106126 Rosetta Predictions rat pricing
NM_027728 Rosetta Predictions mouse pricing
XM_283704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104838 predicted 875
2 SASI_Hs01_00104841 predicted 605
3 SASI_Hs01_00104842 predicted 1111
4 SASI_Hs01_00104843 predicted 1202
5 SASI_Hs01_00104844 predicted 666
6 SASI_Hs01_00104845 predicted 800
7 SASI_Hs02_00364854 predicted 1203
8 SASI_Hs01_00104846 predicted 915
9 SASI_Hs01_00104847 predicted 629
10 SASI_Hs02_00364855 predicted 926
11 SASI_Hs01_00104839 predicted 910
12 SASI_Hs01_00104840 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215878 predicted 225
2 SASI_Rn02_00215879 predicted 672
3 SASI_Rn02_00215880 predicted 234
4 SASI_Rn02_00215881 predicted 602
5 SASI_Rn02_00215882 predicted 235
6 SASI_Rn02_00215883 predicted 612
7 SASI_Rn02_00215884 predicted 278
8 SASI_Rn02_00215885 predicted 552
9 SASI_Rn02_00215886 predicted 221
10 SASI_Rn02_00215887 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332656 predicted 691
2 SASI_Mm02_00332657 predicted 715
3 SASI_Mm02_00332658 predicted 675
4 SASI_Mm02_00332659 predicted 944
5 SASI_Mm02_00332660 predicted 857
6 SASI_Mm02_00332661 predicted 713
7 SASI_Mm02_00332662 predicted 935
8 SASI_Mm02_00332663 predicted 927
9 SASI_Mm02_00332664 predicted 758
10 SASI_Mm02_00332665 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218380 predicted 244
2 SASI_Mm01_00218381 predicted 723
3 SASI_Mm01_00218382 predicted 240
4 SASI_Mm01_00218383 predicted 552
5 SASI_Mm01_00218384 predicted 938
6 SASI_Mm01_00218385 predicted 727
7 SASI_Mm01_00218386 predicted 939
8 SASI_Mm01_00218387 predicted 294
9 SASI_Mm01_00218388 predicted 931
10 SASI_Mm01_00218389 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145010
ENKUR MISSION shRNA Bacterial Glycerol Stock
enkurin, TRPC channel interacting protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145010.2-1251s21c1
Sequence:CCGGCCAACCTCGATACTCTTATTTCTCGAGAAATAAGAGTATCGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145010.2-797s21c1
Sequence:CCGGTCCAGTCCCTCTCGGTCTTTACTCGAGTAAAGACCGAGAGGGACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145010.2-1321s21c1
Sequence:CCGGGGTCCTTTCTACTTATCTATTCTCGAGAATAGATAAGTAGAAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-877s1c1
Sequence:CCGGGAACACGACATTGGCATAATTCTCGAGAATTATGCCAATGTCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-867s1c1
Sequence:CCGGGAAACAACTAGAACACGACATCTCGAGATGTCGTGTTCTAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145010.2-1072s1c1
Sequence:CCGGCCCATGACATTTGCAGTTATTCTCGAGAATAACTGCAAATGTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-442s1c1
Sequence:CCGGGATCATCCTGTCATGGGAATACTCGAGTATTCCCATGACAGGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145010.2-2811s1c1
Sequence:CCGGGCAGCTAGTTTGACTTGGTTTCTCGAGAAACCAAGTCAAACTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-669s1c1
Sequence:CCGGCCAAGAAGACTATGATCGTTACTCGAGTAACGATCATAGTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-874s1c1
Sequence:CCGGCTAGAACACGACATTGGCATACTCGAGTATGCCAATGTCGTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-646s1c1
Sequence:CCGGCGAAACGAGGAAATAAAGAAACTCGAGTTTCTTTATTTCCTCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145010
ENKUR MISSION shRNA shRNA Plasmid DNA
enkurin, TRPC channel interacting protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145010.2-1251s21c1
Sequence:CCGGCCAACCTCGATACTCTTATTTCTCGAGAAATAAGAGTATCGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145010.2-797s21c1
Sequence:CCGGTCCAGTCCCTCTCGGTCTTTACTCGAGTAAAGACCGAGAGGGACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145010.2-1321s21c1
Sequence:CCGGGGTCCTTTCTACTTATCTATTCTCGAGAATAGATAAGTAGAAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-877s1c1
Sequence:CCGGGAACACGACATTGGCATAATTCTCGAGAATTATGCCAATGTCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-867s1c1
Sequence:CCGGGAAACAACTAGAACACGACATCTCGAGATGTCGTGTTCTAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145010.2-1072s1c1
Sequence:CCGGCCCATGACATTTGCAGTTATTCTCGAGAATAACTGCAAATGTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-442s1c1
Sequence:CCGGGATCATCCTGTCATGGGAATACTCGAGTATTCCCATGACAGGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145010.2-2811s1c1
Sequence:CCGGGCAGCTAGTTTGACTTGGTTTCTCGAGAAACCAAGTCAAACTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-669s1c1
Sequence:CCGGCCAAGAAGACTATGATCGTTACTCGAGTAACGATCATAGTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-874s1c1
Sequence:CCGGCTAGAACACGACATTGGCATACTCGAGTATGCCAATGTCGTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-646s1c1
Sequence:CCGGCGAAACGAGGAAATAAAGAAACTCGAGTTTCTTTATTTCCTCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145010
ENKUR MISSION shRNA Lentiviral Transduction Particles
enkurin, TRPC channel interacting protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145010.2-1251s21c1
Sequence:CCGGCCAACCTCGATACTCTTATTTCTCGAGAAATAAGAGTATCGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145010.2-797s21c1
Sequence:CCGGTCCAGTCCCTCTCGGTCTTTACTCGAGTAAAGACCGAGAGGGACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145010.2-1321s21c1
Sequence:CCGGGGTCCTTTCTACTTATCTATTCTCGAGAATAGATAAGTAGAAAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-877s1c1
Sequence:CCGGGAACACGACATTGGCATAATTCTCGAGAATTATGCCAATGTCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-867s1c1
Sequence:CCGGGAAACAACTAGAACACGACATCTCGAGATGTCGTGTTCTAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145010.2-1072s1c1
Sequence:CCGGCCCATGACATTTGCAGTTATTCTCGAGAATAACTGCAAATGTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-442s1c1
Sequence:CCGGGATCATCCTGTCATGGGAATACTCGAGTATTCCCATGACAGGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145010.2-2811s1c1
Sequence:CCGGGCAGCTAGTTTGACTTGGTTTCTCGAGAAACCAAGTCAAACTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-669s1c1
Sequence:CCGGCCAAGAAGACTATGATCGTTACTCGAGTAACGATCATAGTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145010.2-874s1c1
Sequence:CCGGCTAGAACACGACATTGGCATACTCGAGTATGCCAATGTCGTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145010.2-646s1c1
Sequence:CCGGCGAAACGAGGAAATAAAGAAACTCGAGTTTCTTTATTTCCTCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027728
ENKUR MISSION shRNA Bacterial Glycerol Stock
enkurin, TRPC channel interacting protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-775s21c1
Sequence:CCGGGAGACTCTCTGACGAAGAAAGCTCGAGCTTTCTTCGTCAGAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-304s21c1
Sequence:CCGGACTGTTTAGAGCAACTATAAACTCGAGTTTATAGTTGCTCTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-672s21c1
Sequence:CCGGGCATCACGCCTGAGTACATATCTCGAGATATGTACTCAGGCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027728.2-1012s21c1
Sequence:CCGGCCACATGGCCATCACACTAAACTCGAGTTTAGTGTGATGGCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027728
ENKUR MISSION shRNA shRNA Plasmid DNA
enkurin, TRPC channel interacting protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-775s21c1
Sequence:CCGGGAGACTCTCTGACGAAGAAAGCTCGAGCTTTCTTCGTCAGAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-304s21c1
Sequence:CCGGACTGTTTAGAGCAACTATAAACTCGAGTTTATAGTTGCTCTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-672s21c1
Sequence:CCGGGCATCACGCCTGAGTACATATCTCGAGATATGTACTCAGGCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027728.2-1012s21c1
Sequence:CCGGCCACATGGCCATCACACTAAACTCGAGTTTAGTGTGATGGCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027728
ENKUR MISSION shRNA Lentiviral Transduction Particles
enkurin, TRPC channel interacting protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-775s21c1
Sequence:CCGGGAGACTCTCTGACGAAGAAAGCTCGAGCTTTCTTCGTCAGAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-304s21c1
Sequence:CCGGACTGTTTAGAGCAACTATAAACTCGAGTTTATAGTTGCTCTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027728.2-672s21c1
Sequence:CCGGGCATCACGCCTGAGTACATATCTCGAGATATGTACTCAGGCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027728.2-1012s21c1
Sequence:CCGGCCACATGGCCATCACACTAAACTCGAGTTTAGTGTGATGGCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks