EMAIL THIS PAGE TO A FRIEND

ENO1

enolase 1, (alpha)

61 Gene Product Result for
Synonyms: ENO1L1 MPB1 NNE PPH
Gene ID:
Human(2023) Summary: This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011]
Mouse(13806) enolase 1, alpha non-neuron
Rat(24333) enolase 1, (alpha)
domestic cat(101093622) enolase 1, (alpha)
cow(281141) enolase 1, (alpha)
Horse(100051879) enolase 1, (alpha)
dog(479597) enolase 1, (alpha)
chicken(396017) enolase 1, (alpha)
sheep(101118119) enolase 1, (alpha)
Domestic Rabbit(100352426) enolase 1, (alpha)
sheep(100190974) enolase 1, (alpha)
domestic guinea pig(100306968) enolase 1, alpha non-neuron
naked mole-rat(101719336) enolase 1, (alpha)
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E2659 Anti-ENO1 (186-200) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
E2784 Anti-ENO1 (416-430) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV34376 Anti-ENO1 (AB1) antibody produced in rabbit IgG fraction of antiserum canine, sheep, rat, rabbit, horse, bovine, mouse, human, guinea pig
western blot pricing
GW22683 Anti-ENO1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB2107950 Anti-ENO1 antibody produced in rabbit IgG fraction of antiserum zebrafish, human, guinea pig, rabbit, rat, sheep, mouse
western blot pricing
AV34377 Anti-ENO1 antibody produced in rabbit affinity isolated antibody mouse, horse, guinea pig, pig, human, rabbit, rat
immunohistochemistry, western blot pricing
SAB2106422 Anti-ENO1 antibody produced in rabbit affinity isolated antibody human, rat, horse, rabbit, guinea pig
ELISA, western blot pricing
HPA068284 Anti-ENO2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1306663 ANTI-ENOA(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunofluorescence, western blot pricing
WH0002023M1 Monoclonal Anti-ENO1 antibody produced in mouse clone 8G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403772 Monoclonal Anti-ENO1 antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP6109 α-Enolase human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing

Kits

Product # Description Species Add to Cart
 
MAK178 Enolase Activity Assay Kit Sufficient for 100 Colorimetric or Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001428 Rosetta Predictions human pricing
NM_001109908 Rosetta Predictions rat pricing
NM_012554 Rosetta Predictions rat pricing
NM_023119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208718 predicted 462
2 SASI_Hs01_00208714 predicted 910
3 SASI_Hs01_00208715 predicted 499
4 SASI_Hs01_00208716 predicted 1012
5 SASI_Hs01_00208719 predicted 1284
6 SASI_Hs01_00208717 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250862 predicted 1266
2 SASI_Rn02_00250863 predicted 1501
3 SASI_Rn02_00250864 predicted 1284
4 SASI_Rn02_00250865 predicted 1026
5 SASI_Rn02_00250866 predicted 1133
6 SASI_Rn02_00250867 predicted 771
7 SASI_Rn02_00250868 predicted 868
8 SASI_Rn02_00250869 predicted 634
9 SASI_Rn02_00250870 predicted 573
10 SASI_Rn02_00250871 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259655 predicted 1190
2 SASI_Rn02_00259656 predicted 1425
3 SASI_Rn02_00259657 predicted 1208
4 SASI_Rn02_00259658 predicted 951
5 SASI_Rn02_00259659 predicted 1057
6 SASI_Rn02_00259660 predicted 699
7 SASI_Rn02_00259661 predicted 796
8 SASI_Rn02_00259662 predicted 554
9 SASI_Rn02_00259663 predicted 490
10 SASI_Rn02_00259664 predicted 768
11 SASI_Rn01_00047939 predicted 696
12 SASI_Rn01_00047940 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095724 predicted 856
2 SASI_Mm02_00326809 predicted 207
3 SASI_Mm02_00326810 predicted 211
4 SASI_Mm01_00095726 predicted 470
5 SASI_Mm01_00095728 predicted 827
6 SASI_Mm01_00095729 predicted 1012
7 SASI_Mm02_00326811 predicted 950
8 SASI_Mm01_00095730 predicted 387
9 SASI_Mm01_00095731 predicted 1080
10 SASI_Mm01_00095732 predicted 692
11 SASI_Mm01_00095725 predicted 1501
12 SASI_Mm01_00095727 predicted 1165
13 SASI_Mm01_00095733 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023119
ENO1 MISSION shRNA Bacterial Glycerol Stock
enolase 1, (alpha)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-324s1c1
Sequence:CCGGCTGGTTAGCAAGAAAGTGAATCTCGAGATTCACTTTCTTGCTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023119.1-1562s1c1
Sequence:CCGGCAATCATGTGATTGGTCTGAACTCGAGTTCAGACCAATCACATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-536s1c1
Sequence:CCGGCCCGGCTTTCAATGTGATCAACTCGAGTTGATCACATTGAAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-738s1c1
Sequence:CCGGCCTAACATCCTGGAGAACAAACTCGAGTTTGTTCTCCAGGATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-389s1c1
Sequence:CCGGCGGCACAGAGAATAAATCTAACTCGAGTTAGATTTATTCTCTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023119
ENO1 MISSION shRNA shRNA Plasmid DNA
enolase 1, (alpha)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-324s1c1
Sequence:CCGGCTGGTTAGCAAGAAAGTGAATCTCGAGATTCACTTTCTTGCTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023119.1-1562s1c1
Sequence:CCGGCAATCATGTGATTGGTCTGAACTCGAGTTCAGACCAATCACATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-536s1c1
Sequence:CCGGCCCGGCTTTCAATGTGATCAACTCGAGTTGATCACATTGAAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-738s1c1
Sequence:CCGGCCTAACATCCTGGAGAACAAACTCGAGTTTGTTCTCCAGGATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-389s1c1
Sequence:CCGGCGGCACAGAGAATAAATCTAACTCGAGTTAGATTTATTCTCTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023119
ENO1 MISSION shRNA Lentiviral Transduction Particles
enolase 1, (alpha)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-324s1c1
Sequence:CCGGCTGGTTAGCAAGAAAGTGAATCTCGAGATTCACTTTCTTGCTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023119.1-1562s1c1
Sequence:CCGGCAATCATGTGATTGGTCTGAACTCGAGTTCAGACCAATCACATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-536s1c1
Sequence:CCGGCCCGGCTTTCAATGTGATCAACTCGAGTTGATCACATTGAAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-738s1c1
Sequence:CCGGCCTAACATCCTGGAGAACAAACTCGAGTTTGTTCTCCAGGATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023119.1-389s1c1
Sequence:CCGGCGGCACAGAGAATAAATCTAACTCGAGTTAGATTTATTCTCTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001428
VALIDATED
ENO1 MISSION shRNA Bacterial Glycerol Stock
enolase 1, (alpha)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-204s1c1
Sequence:CCGGCCACTGTTGAGGTTGATCTCTCTCGAGAGAGATCAACCTCAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001428.2-593s1c1
Sequence:CCGGCCGGCGTTCAATGTCATCAATCTCGAGATTGATGACATTGAACGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-1144s1c1
Sequence:CCGGCGTGAACGAGAAGTCCTGCAACTCGAGTTGCAGGACTTCTCGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-730s1c1
Sequence:CCGGGAATGTCATCAAGGAGAAATACTCGAGTATTTCTCCTTGATGACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-1592s1c1
Sequence:CCGGCGTACCGCTTCCTTAGAACTTCTCGAGAAGTTCTAAGGAAGCGGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-730s21c1
Sequence:CCGGGAATGTCATCAAGGAGAAATACTCGAGTATTTCTCCTTGATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-1144s21c1
Sequence:CCGGCGTGAACGAGAAGTCCTGCAACTCGAGTTGCAGGACTTCTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001428.2-1592s21c1
Sequence:CCGGCGTACCGCTTCCTTAGAACTTCTCGAGAAGTTCTAAGGAAGCGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-204s21c1
Sequence:CCGGCCACTGTTGAGGTTGATCTCTCTCGAGAGAGATCAACCTCAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001428
VALIDATED
ENO1 MISSION shRNA shRNA Plasmid DNA
enolase 1, (alpha)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-204s1c1
Sequence:CCGGCCACTGTTGAGGTTGATCTCTCTCGAGAGAGATCAACCTCAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001428.2-593s1c1
Sequence:CCGGCCGGCGTTCAATGTCATCAATCTCGAGATTGATGACATTGAACGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-1144s1c1
Sequence:CCGGCGTGAACGAGAAGTCCTGCAACTCGAGTTGCAGGACTTCTCGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-730s1c1
Sequence:CCGGGAATGTCATCAAGGAGAAATACTCGAGTATTTCTCCTTGATGACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-1592s1c1
Sequence:CCGGCGTACCGCTTCCTTAGAACTTCTCGAGAAGTTCTAAGGAAGCGGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-730s21c1
Sequence:CCGGGAATGTCATCAAGGAGAAATACTCGAGTATTTCTCCTTGATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-1144s21c1
Sequence:CCGGCGTGAACGAGAAGTCCTGCAACTCGAGTTGCAGGACTTCTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001428.2-1592s21c1
Sequence:CCGGCGTACCGCTTCCTTAGAACTTCTCGAGAAGTTCTAAGGAAGCGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-204s21c1
Sequence:CCGGCCACTGTTGAGGTTGATCTCTCTCGAGAGAGATCAACCTCAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001428
VALIDATED
ENO1 MISSION shRNA Lentiviral Transduction Particles
enolase 1, (alpha)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-204s1c1
Sequence:CCGGCCACTGTTGAGGTTGATCTCTCTCGAGAGAGATCAACCTCAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001428.2-593s1c1
Sequence:CCGGCCGGCGTTCAATGTCATCAATCTCGAGATTGATGACATTGAACGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-1144s1c1
Sequence:CCGGCGTGAACGAGAAGTCCTGCAACTCGAGTTGCAGGACTTCTCGTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-730s1c1
Sequence:CCGGGAATGTCATCAAGGAGAAATACTCGAGTATTTCTCCTTGATGACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001428.2-1592s1c1
Sequence:CCGGCGTACCGCTTCCTTAGAACTTCTCGAGAAGTTCTAAGGAAGCGGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-730s21c1
Sequence:CCGGGAATGTCATCAAGGAGAAATACTCGAGTATTTCTCCTTGATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-1144s21c1
Sequence:CCGGCGTGAACGAGAAGTCCTGCAACTCGAGTTGCAGGACTTCTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001428.2-1592s21c1
Sequence:CCGGCGTACCGCTTCCTTAGAACTTCTCGAGAAGTTCTAAGGAAGCGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001428.2-204s21c1
Sequence:CCGGCCACTGTTGAGGTTGATCTCTCTCGAGAGAGATCAACCTCAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks