EMAIL THIS PAGE TO A FRIEND

ENO2

enolase 2 (gamma, neuronal)

64 Gene Product Result for
Synonyms: NSE
UniProtKB ID: P09104, Q96J33
Gene ID:
Human(2026) Summary: This gene encodes one of the three enolase isoenzymes found in mammals. This isoenzyme, a homodimer, is found in mature neurons and cells of neuronal origin. A switch from alpha enolase to gamma enolase occurs in neural tissue during development in rats and primates. [provided by RefSeq, Jul 2008]
Mouse(13807) enolase 2, gamma neuronal
Rat(24334) enolase 2, gamma, neuronal
Zebrafish(402874) enolase 2
cow(526006) enolase 2 (gamma, neuronal)
Horse(100052776) enolase 2 (gamma, neuronal)
dog(477709) enolase 2 (gamma, neuronal)
domestic cat(101086660) enolase 2 (gamma, neuronal)
chicken(395689) enolase 2 (gamma, neuronal)
domestic guinea pig(100723977) enolase 2 (gamma, neuronal)
naked mole-rat(101721709) enolase 2 (gamma, neuronal)
sheep(101109164) enolase 2 (gamma, neuronal)
Domestic Rabbit(100348989) enolase 2 (gamma, neuronal)
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701669 Anti-eno2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB1408571 Anti-ENO2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
N0649 Anti-Neuronal Specific Enolase antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry pricing
SAB1305394 ANTI-NSE (Y236) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305395 ANTI-NSE (Y25) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB4300698 Anti-NSE antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4500768 Anti-NSE, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1305089 ANTI-PHOSPHO-NSE(Y236) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
WH0002026M1 Monoclonal Anti-ENO2 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403773 Monoclonal Anti-ENO2 antibody produced in mouse clone 3B5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4200571 Monoclonal Anti-Neuron-Specific Enolase (NSE) antibody produced in mouse ~1.0 mg/mL, clone NSE-P1, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB4200572 Monoclonal Anti-Neuron-Specific Enolase (NSE) antibody produced in mouse ~1.0 mg/mL, clone NSE-P2, affinity isolated antibody human, rat
immunohistochemistry, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK178 Enolase Activity Assay Kit Sufficient for 100 Colorimetric or Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001975 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001975 Rosetta Predictions human pricing
NM_139325 Rosetta Predictions rat pricing
NM_013509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132124 predicted 936
2 SASI_Hs01_00132125 predicted 1774
3 SASI_Hs01_00132126 predicted 984
4 SASI_Hs01_00132127 predicted 1095
5 SASI_Hs01_00132128 predicted 1418
6 SASI_Hs01_00132129 predicted 949
7 SASI_Hs01_00132130 predicted 443
8 SASI_Hs01_00132131 predicted 1009
9 SASI_Hs01_00132132 predicted 1193
10 SASI_Hs01_00132133 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268560 predicted 756
2 SASI_Rn01_00030270 predicted 1004
3 SASI_Rn01_00030272 predicted 685
4 SASI_Rn02_00268561 predicted 222
5 SASI_Rn01_00030273 predicted 292
6 SASI_Rn01_00030275 predicted 1029
7 SASI_Rn02_00268562 predicted 795
8 SASI_Rn02_00268563 predicted 529
9 SASI_Rn02_00268564 predicted 1007
10 SASI_Rn02_00268565 predicted 995
11 SASI_Rn01_00030268 predicted 296
12 SASI_Rn01_00030269 predicted 1336
13 SASI_Rn01_00030271 predicted 1327
14 SASI_Rn01_00030274 predicted 1296
15 SASI_Rn01_00030276 predicted 1297
16 SASI_Rn01_00030277 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106092 predicted 1002
2 SASI_Mm01_00106093 predicted 381
3 SASI_Mm01_00106094 predicted 248
4 SASI_Mm01_00106095 predicted 842
5 SASI_Mm01_00106096 predicted 1090
6 SASI_Mm01_00106097 predicted 1281
7 SASI_Mm01_00106098 predicted 1420
8 SASI_Mm01_00106099 predicted 307
9 SASI_Mm01_00106100 predicted 364
10 SASI_Mm01_00106101 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013509
VALIDATED
ENO2 MISSION shRNA Bacterial Glycerol Stock
enolase 2 (gamma, neuronal)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-1104s21c1
Sequence:CCGGGTTTGCTGCTCAAGGTCAATCCTCGAGGATTGACCTTGAGCAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013509.2-144s21c1
Sequence:CCGGCCGTGGAGGTGGATCTCTATACTCGAGTATAGAGATCCACCTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-930s21c1
Sequence:CCGGAGGACTTTGTCCGGAACTATCCTCGAGGATAGTTCCGGACAAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013509.2-1351s21c1
Sequence:CCGGTCGCTTCGCGGGACATAATTTCTCGAGAAATTATGTCCCGCGAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-1420s21c1
Sequence:CCGGGAACGCGGGAACATCTCATTCCTCGAGGAATGAGATGTTCCCGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013509.2-1469s1c1
Sequence:CCGGCCTGCCATAGTCACTCTGATACTCGAGTATCAGAGTGACTATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-1357s1c1
Sequence:CCGGCGCGGGACATAATTTCCGAAACTCGAGTTTCGGAAATTATGTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-848s1c1
Sequence:CCGGGATGGCAAATACGACTTGGATCTCGAGATCCAAGTCGTATTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-1356s1c1
Sequence:CCGGTCGCGGGACATAATTTCCGAACTCGAGTTCGGAAATTATGTCCCGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-152s1c1
Sequence:CCGGGTGGATCTCTATACTGCCAAACTCGAGTTTGGCAGTATAGAGATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013509
VALIDATED
ENO2 MISSION shRNA shRNA Plasmid DNA
enolase 2 (gamma, neuronal)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-1104s21c1
Sequence:CCGGGTTTGCTGCTCAAGGTCAATCCTCGAGGATTGACCTTGAGCAGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013509.2-144s21c1
Sequence:CCGGCCGTGGAGGTGGATCTCTATACTCGAGTATAGAGATCCACCTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-930s21c1
Sequence:CCGGAGGACTTTGTCCGGAACTATCCTCGAGGATAGTTCCGGACAAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013509.2-1351s21c1
Sequence:CCGGTCGCTTCGCGGGACATAATTTCTCGAGAAATTATGTCCCGCGAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-1420s21c1
Sequence:CCGGGAACGCGGGAACATCTCATTCCTCGAGGAATGAGATGTTCCCGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013509.2-1469s1c1
Sequence:CCGGCCTGCCATAGTCACTCTGATACTCGAGTATCAGAGTGACTATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-1357s1c1
Sequence:CCGGCGCGGGACATAATTTCCGAAACTCGAGTTTCGGAAATTATGTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-848s1c1
Sequence:CCGGGATGGCAAATACGACTTGGATCTCGAGATCCAAGTCGTATTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-1356s1c1
Sequence:CCGGTCGCGGGACATAATTTCCGAACTCGAGTTCGGAAATTATGTCCCGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-152s1c1
Sequence:CCGGGTGGATCTCTATACTGCCAAACTCGAGTTTGGCAGTATAGAGATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013509
VALIDATED
ENO2 MISSION shRNA Lentiviral Transduction Particles
enolase 2 (gamma, neuronal)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-1104s21c1
Sequence:CCGGGTTTGCTGCTCAAGGTCAATCCTCGAGGATTGACCTTGAGCAGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013509.2-144s21c1
Sequence:CCGGCCGTGGAGGTGGATCTCTATACTCGAGTATAGAGATCCACCTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-930s21c1
Sequence:CCGGAGGACTTTGTCCGGAACTATCCTCGAGGATAGTTCCGGACAAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013509.2-1351s21c1
Sequence:CCGGTCGCTTCGCGGGACATAATTTCTCGAGAAATTATGTCCCGCGAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013509.2-1420s21c1
Sequence:CCGGGAACGCGGGAACATCTCATTCCTCGAGGAATGAGATGTTCCCGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114541    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013509.2-1469s1c1
Sequence:CCGGCCTGCCATAGTCACTCTGATACTCGAGTATCAGAGTGACTATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-1357s1c1
Sequence:CCGGCGCGGGACATAATTTCCGAAACTCGAGTTTCGGAAATTATGTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-848s1c1
Sequence:CCGGGATGGCAAATACGACTTGGATCTCGAGATCCAAGTCGTATTTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-1356s1c1
Sequence:CCGGTCGCGGGACATAATTTCCGAACTCGAGTTCGGAAATTATGTCCCGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013509.2-152s1c1
Sequence:CCGGGTGGATCTCTATACTGCCAAACTCGAGTTTGGCAGTATAGAGATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001975
VALIDATED
ENO2 MISSION shRNA Bacterial Glycerol Stock
enolase 2 (gamma, neuronal)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-1420s21c1
Sequence:CCGGCGTTCTGAACGTCTGGCTAAACTCGAGTTTAGCCAGACGTTCAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-1992s21c1
Sequence:CCGGCGCCTGGCTAATAAGGCTTTACTCGAGTAAAGCCTTATTAGCCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-798s21c1
Sequence:CCGGCAAGGGAGTCATCAAGGACAACTCGAGTTGTCCTTGATGACTCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001975.2-289s21c1
Sequence:CCGGGATCTCTATACTGCCAAAGGTCTCGAGACCTTTGGCAGTATAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-1735s1c1
Sequence:CCGGCGCACTTTCCACTTCTTCCTTCTCGAGAAGGAAGAAGTGGAAAGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001975.2-1992s1c1
Sequence:CCGGCGCCTGGCTAATAAGGCTTTACTCGAGTAAAGCCTTATTAGCCAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-387s1c1
Sequence:CCGGGCGTTACTTAGGCAAAGGTGTCTCGAGACACCTTTGCCTAAGTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001975.2-1492s1c1
Sequence:CCGGGCCGGACATAACTTCCGTAATCTCGAGATTACGGAAGTTATGTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-798s1c1
Sequence:CCGGCAAGGGAGTCATCAAGGACAACTCGAGTTGTCCTTGATGACTCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-1420s1c1
Sequence:CCGGCGTTCTGAACGTCTGGCTAAACTCGAGTTTAGCCAGACGTTCAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-807s1c1
Sequence:CCGGCATCAAGGACAAATACGGCAACTCGAGTTGCCGTATTTGTCCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001975.2-289s1c1
Sequence:CCGGGATCTCTATACTGCCAAAGGTCTCGAGACCTTTGGCAGTATAGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-381s1c1
Sequence:CCGGCAAACAGCGTTACTTAGGCAACTCGAGTTGCCTAAGTAACGCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001975
VALIDATED
ENO2 MISSION shRNA shRNA Plasmid DNA
enolase 2 (gamma, neuronal)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-1420s21c1
Sequence:CCGGCGTTCTGAACGTCTGGCTAAACTCGAGTTTAGCCAGACGTTCAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-1992s21c1
Sequence:CCGGCGCCTGGCTAATAAGGCTTTACTCGAGTAAAGCCTTATTAGCCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-798s21c1
Sequence:CCGGCAAGGGAGTCATCAAGGACAACTCGAGTTGTCCTTGATGACTCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001975.2-289s21c1
Sequence:CCGGGATCTCTATACTGCCAAAGGTCTCGAGACCTTTGGCAGTATAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-1735s1c1
Sequence:CCGGCGCACTTTCCACTTCTTCCTTCTCGAGAAGGAAGAAGTGGAAAGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001975.2-1992s1c1
Sequence:CCGGCGCCTGGCTAATAAGGCTTTACTCGAGTAAAGCCTTATTAGCCAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-387s1c1
Sequence:CCGGGCGTTACTTAGGCAAAGGTGTCTCGAGACACCTTTGCCTAAGTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001975.2-1492s1c1
Sequence:CCGGGCCGGACATAACTTCCGTAATCTCGAGATTACGGAAGTTATGTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-798s1c1
Sequence:CCGGCAAGGGAGTCATCAAGGACAACTCGAGTTGTCCTTGATGACTCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-1420s1c1
Sequence:CCGGCGTTCTGAACGTCTGGCTAAACTCGAGTTTAGCCAGACGTTCAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-807s1c1
Sequence:CCGGCATCAAGGACAAATACGGCAACTCGAGTTGCCGTATTTGTCCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001975.2-289s1c1
Sequence:CCGGGATCTCTATACTGCCAAAGGTCTCGAGACCTTTGGCAGTATAGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-381s1c1
Sequence:CCGGCAAACAGCGTTACTTAGGCAACTCGAGTTGCCTAAGTAACGCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001975
VALIDATED
ENO2 MISSION shRNA Lentiviral Transduction Particles
enolase 2 (gamma, neuronal)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-1420s21c1
Sequence:CCGGCGTTCTGAACGTCTGGCTAAACTCGAGTTTAGCCAGACGTTCAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-1992s21c1
Sequence:CCGGCGCCTGGCTAATAAGGCTTTACTCGAGTAAAGCCTTATTAGCCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001975.2-798s21c1
Sequence:CCGGCAAGGGAGTCATCAAGGACAACTCGAGTTGTCCTTGATGACTCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001975.2-289s21c1
Sequence:CCGGGATCTCTATACTGCCAAAGGTCTCGAGACCTTTGGCAGTATAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-1735s1c1
Sequence:CCGGCGCACTTTCCACTTCTTCCTTCTCGAGAAGGAAGAAGTGGAAAGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001975.2-1992s1c1
Sequence:CCGGCGCCTGGCTAATAAGGCTTTACTCGAGTAAAGCCTTATTAGCCAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-387s1c1
Sequence:CCGGGCGTTACTTAGGCAAAGGTGTCTCGAGACACCTTTGCCTAAGTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001975.2-1492s1c1
Sequence:CCGGGCCGGACATAACTTCCGTAATCTCGAGATTACGGAAGTTATGTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-798s1c1
Sequence:CCGGCAAGGGAGTCATCAAGGACAACTCGAGTTGTCCTTGATGACTCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-1420s1c1
Sequence:CCGGCGTTCTGAACGTCTGGCTAAACTCGAGTTTAGCCAGACGTTCAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001975.2-807s1c1
Sequence:CCGGCATCAAGGACAAATACGGCAACTCGAGTTGCCGTATTTGTCCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001975.2-289s1c1
Sequence:CCGGGATCTCTATACTGCCAAAGGTCTCGAGACCTTTGGCAGTATAGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001975.2-381s1c1
Sequence:CCGGCAAACAGCGTTACTTAGGCAACTCGAGTTGCCTAAGTAACGCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)