EMAIL THIS PAGE TO A FRIEND

ENO3

enolase 3 (beta, muscle)

70 Gene Product Result for
Synonyms: GSD13 MSE
UniProtKB ID: P13929, B4DUI6, B4DUM6, D3DTL2, E7ENK8, Q96AE2
Gene ID:
Human(2027) Summary: This gene encodes one of the three enolase isoenzymes found in mammals. This isoenzyme is found in skeletal muscle cells in the adult where it may play a role in muscle development and regeneration. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in this gene have be associated glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jul 2010]
Mouse(13808) enolase 3, beta muscle
Rat(25438) enolase 3, beta, muscle
Domestic Rabbit(100008769) enolase 3 (beta, muscle)
naked mole-rat(101720130) enolase 3 (beta, muscle)
domestic guinea pig(100723905) enolase 3 (beta, muscle)
Zebrafish(378963) enolase 3, (beta, muscle)
cow(540303) enolase 3 (beta, muscle)
Horse(100061187) enolase 3 (beta, muscle)
domestic cat(101091162) enolase 3 (beta, muscle)
dog(479469) enolase 3 (beta, muscle)
chicken(396016) enolase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001976 Rosetta Predictions human pricing
NM_053013 Rosetta Predictions human pricing
NM_012949 Rosetta Predictions rat pricing
NM_007933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228412 predicted 425
2 SASI_Hs01_00228413 predicted 1198
3 SASI_Hs01_00228415 predicted 375
4 SASI_Hs01_00228416 predicted 890
5 SASI_Hs01_00228417 predicted 954
6 SASI_Hs01_00228419 predicted 1288
7 SASI_Hs01_00228420 predicted 963
8 SASI_Hs01_00228421 predicted 682
9 SASI_Hs02_00332947 predicted 1112
10 SASI_Hs02_00332948 predicted 418
11 SASI_Hs01_00228414 predicted 522
12 SASI_Hs01_00228418 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193497 predicted 383
2 SASI_Hs01_00193498 predicted 1153
3 SASI_Hs01_00193500 predicted 324
4 SASI_Hs01_00193501 predicted 849
5 SASI_Hs01_00193502 predicted 908
6 SASI_Hs01_00193504 predicted 1249
7 SASI_Hs01_00193505 predicted 922
8 SASI_Hs01_00193506 predicted 635
9 SASI_Hs02_00361837 predicted 1063
10 SASI_Hs02_00361838 predicted 380
11 SASI_Hs01_00193499 predicted 476
12 SASI_Hs01_00193503 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038269 predicted 1023
2 SASI_Rn01_00038271 predicted 455
3 SASI_Rn02_00260523 predicted 1110
4 SASI_Rn01_00038273 predicted 1057
5 SASI_Rn01_00038275 predicted 1021
6 SASI_Rn01_00038276 predicted 349
7 SASI_Rn01_00038277 predicted 708
8 SASI_Rn02_00260524 predicted 716
9 SASI_Rn02_00260525 predicted 1116
10 SASI_Rn01_00038274 predicted 595
11 SASI_Rn01_00038270 predicted 565
12 SASI_Rn01_00038272 predicted 1072
13 SASI_Rn01_00038278 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055767 predicted 1086
2 SASI_Mm01_00055768 predicted 1070
3 SASI_Mm01_00055769 predicted 865
4 SASI_Mm01_00055771 predicted 1132
5 SASI_Mm02_00312768 predicted 1080
6 SASI_Mm01_00055772 predicted 1008
7 SASI_Mm01_00055773 predicted 1095
8 SASI_Mm01_00055774 predicted 1221
9 SASI_Mm01_00055775 predicted 371
10 SASI_Mm02_00312769 predicted 777
11 SASI_Mm01_00055766 predicted 1149
12 SASI_Mm01_00055770 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001976
VALIDATED
ENO3 MISSION shRNA Bacterial Glycerol Stock
enolase 3 (beta, muscle)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-850s1c1
Sequence:CCGGGCATCTGAGTTCTATCGCAATCTCGAGATTGCGATAGAACTCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001976.2-883s1c1
Sequence:CCGGCTTGACTTCAAGTCGCCTGATCTCGAGATCAGGCGACTTGAAGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-942s1c1
Sequence:CCGGGCTGTATAAGAGCTTTATCAACTCGAGTTGATAAAGCTCTTATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-939s1c1
Sequence:CCGGAGAGCTGTATAAGAGCTTTATCTCGAGATAAAGCTCTTATACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001976.2-406s1c1
Sequence:CCGGACCGAGAATAAGTCCAAGTTTCTCGAGAAACTTGGACTTATTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-669s21c1
Sequence:CCGGTCAAGGAAGCCATGCGCATTGCTCGAGCAATGCGCATGGCTTCCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-1190s21c1
Sequence:CCGGGAATCGATCCAGGCGTGCAAACTCGAGTTTGCACGCCTGGATCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-404s21c1
Sequence:CCGGGTTGACAAATTTATGATTGAGCTCGAGCTCAATCATAAATTTGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-265s21c1
Sequence:CCGGCTATGAGGCTCTGGAACTAAGCTCGAGCTTAGTTCCAGAGCCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-1400s21c1
Sequence:CCGGATCTTTGCTGGACGCAAGTTCCTCGAGGAACTTGCGTCCAGCAAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-335s21c1
Sequence:CCGGGAGAACATCAACAGTACTCTGCTCGAGCAGAGTACTGTTGATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001976
VALIDATED
ENO3 MISSION shRNA shRNA Plasmid DNA
enolase 3 (beta, muscle)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-850s1c1
Sequence:CCGGGCATCTGAGTTCTATCGCAATCTCGAGATTGCGATAGAACTCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001976.2-883s1c1
Sequence:CCGGCTTGACTTCAAGTCGCCTGATCTCGAGATCAGGCGACTTGAAGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-942s1c1
Sequence:CCGGGCTGTATAAGAGCTTTATCAACTCGAGTTGATAAAGCTCTTATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-939s1c1
Sequence:CCGGAGAGCTGTATAAGAGCTTTATCTCGAGATAAAGCTCTTATACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001976.2-406s1c1
Sequence:CCGGACCGAGAATAAGTCCAAGTTTCTCGAGAAACTTGGACTTATTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-669s21c1
Sequence:CCGGTCAAGGAAGCCATGCGCATTGCTCGAGCAATGCGCATGGCTTCCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-1190s21c1
Sequence:CCGGGAATCGATCCAGGCGTGCAAACTCGAGTTTGCACGCCTGGATCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-404s21c1
Sequence:CCGGGTTGACAAATTTATGATTGAGCTCGAGCTCAATCATAAATTTGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-265s21c1
Sequence:CCGGCTATGAGGCTCTGGAACTAAGCTCGAGCTTAGTTCCAGAGCCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-1400s21c1
Sequence:CCGGATCTTTGCTGGACGCAAGTTCCTCGAGGAACTTGCGTCCAGCAAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-335s21c1
Sequence:CCGGGAGAACATCAACAGTACTCTGCTCGAGCAGAGTACTGTTGATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001976
VALIDATED
ENO3 MISSION shRNA Lentiviral Transduction Particles
enolase 3 (beta, muscle)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-850s1c1
Sequence:CCGGGCATCTGAGTTCTATCGCAATCTCGAGATTGCGATAGAACTCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001976.2-883s1c1
Sequence:CCGGCTTGACTTCAAGTCGCCTGATCTCGAGATCAGGCGACTTGAAGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-942s1c1
Sequence:CCGGGCTGTATAAGAGCTTTATCAACTCGAGTTGATAAAGCTCTTATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001976.2-939s1c1
Sequence:CCGGAGAGCTGTATAAGAGCTTTATCTCGAGATAAAGCTCTTATACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001976.2-406s1c1
Sequence:CCGGACCGAGAATAAGTCCAAGTTTCTCGAGAAACTTGGACTTATTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-669s21c1
Sequence:CCGGTCAAGGAAGCCATGCGCATTGCTCGAGCAATGCGCATGGCTTCCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-1190s21c1
Sequence:CCGGGAATCGATCCAGGCGTGCAAACTCGAGTTTGCACGCCTGGATCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-404s21c1
Sequence:CCGGGTTGACAAATTTATGATTGAGCTCGAGCTCAATCATAAATTTGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-265s21c1
Sequence:CCGGCTATGAGGCTCTGGAACTAAGCTCGAGCTTAGTTCCAGAGCCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-1400s21c1
Sequence:CCGGATCTTTGCTGGACGCAAGTTCCTCGAGGAACTTGCGTCCAGCAAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001976.3-335s21c1
Sequence:CCGGGAGAACATCAACAGTACTCTGCTCGAGCAGAGTACTGTTGATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007933
VALIDATED
ENO3 MISSION shRNA Bacterial Glycerol Stock
enolase 3 (beta, muscle)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-1012s1c1
Sequence:CCGGGACATCCAGATTGTGGGAGATCTCGAGATCTCCCACAATCTGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-819s1c1
Sequence:CCGGTGCGTCTGAATTCTACCGCAACTCGAGTTGCGGTAGAATTCAGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007933.2-603s1c1
Sequence:CCGGCAGCTCTTTCAAGGAAGCCATCTCGAGATGGCTTCCTTGAAAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-277s1c1
Sequence:CCGGGAACACATCAACAAGACTCTACTCGAGTAGAGTCTTGTTGATGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-1348s1c1
Sequence:CCGGGCTGGAAGAAAGTTCCGTAATCTCGAGATTACGGAACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-1348s21c2
Sequence:CCGGGCTGGAAGAAAGTTCCGTAATCTCGAGATTACGGAACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-1012s21c2
Sequence:CCGGGACATCCAGATTGTGGGAGATCTCGAGATCTCCCACAATCTGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-277s21c3
Sequence:CCGGGAACACATCAACAAGACTCTACTCGAGTAGAGTCTTGTTGATGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-819s21c2
Sequence:CCGGTGCGTCTGAATTCTACCGCAACTCGAGTTGCGGTAGAATTCAGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007933
VALIDATED
ENO3 MISSION shRNA shRNA Plasmid DNA
enolase 3 (beta, muscle)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-1012s1c1
Sequence:CCGGGACATCCAGATTGTGGGAGATCTCGAGATCTCCCACAATCTGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-819s1c1
Sequence:CCGGTGCGTCTGAATTCTACCGCAACTCGAGTTGCGGTAGAATTCAGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007933.2-603s1c1
Sequence:CCGGCAGCTCTTTCAAGGAAGCCATCTCGAGATGGCTTCCTTGAAAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-277s1c1
Sequence:CCGGGAACACATCAACAAGACTCTACTCGAGTAGAGTCTTGTTGATGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-1348s1c1
Sequence:CCGGGCTGGAAGAAAGTTCCGTAATCTCGAGATTACGGAACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-1348s21c2
Sequence:CCGGGCTGGAAGAAAGTTCCGTAATCTCGAGATTACGGAACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-1012s21c2
Sequence:CCGGGACATCCAGATTGTGGGAGATCTCGAGATCTCCCACAATCTGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-277s21c3
Sequence:CCGGGAACACATCAACAAGACTCTACTCGAGTAGAGTCTTGTTGATGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-819s21c2
Sequence:CCGGTGCGTCTGAATTCTACCGCAACTCGAGTTGCGGTAGAATTCAGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007933
VALIDATED
ENO3 MISSION shRNA Lentiviral Transduction Particles
enolase 3 (beta, muscle)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-1012s1c1
Sequence:CCGGGACATCCAGATTGTGGGAGATCTCGAGATCTCCCACAATCTGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-819s1c1
Sequence:CCGGTGCGTCTGAATTCTACCGCAACTCGAGTTGCGGTAGAATTCAGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007933.2-603s1c1
Sequence:CCGGCAGCTCTTTCAAGGAAGCCATCTCGAGATGGCTTCCTTGAAAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-277s1c1
Sequence:CCGGGAACACATCAACAAGACTCTACTCGAGTAGAGTCTTGTTGATGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007933.2-1348s1c1
Sequence:CCGGGCTGGAAGAAAGTTCCGTAATCTCGAGATTACGGAACTTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-1348s21c2
Sequence:CCGGGCTGGAAGAAAGTTCCGTAATCTCGAGATTACGGAACTTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-1012s21c2
Sequence:CCGGGACATCCAGATTGTGGGAGATCTCGAGATCTCCCACAATCTGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-277s21c3
Sequence:CCGGGAACACATCAACAAGACTCTACTCGAGTAGAGTCTTGTTGATGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007933.2-819s21c2
Sequence:CCGGTGCGTCTGAATTCTACCGCAACTCGAGTTGCGGTAGAATTCAGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)