EMAIL THIS PAGE TO A FRIEND

ENO4

enolase family member 4

Synonyms: AC023283.3 C10orf134
UniProtKB ID: A6NNW6, B8ZZN9
Gene ID:
Mouse(226265) enolase 4
Rat(292138) enolase family member 4
Zebrafish(558487) enolase family member 4
chicken(423918) enolase family member 4
domestic cat(101085751) enolase family member 4
cow(767880) enolase family member 4
Horse(100067539) enolase family member 4
dog(477832) enolase family member 4
domestic guinea pig(100719933) enolase family member 4
naked mole-rat(101698301) enolase family member 4
sheep(101104109) enolase family member 4
Domestic Rabbit(100350280) enolase family member 4
Gene Class: Dehydratase
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK178 Enolase Activity Assay Kit Sufficient for 100 Colorimetric or Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080371 MISSION® esiRNA esiRNA targeting mouse 6430537H07Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721847 Rosetta Predictions human pricing
XM_370577 Rosetta Predictions human pricing
XM_939821 Rosetta Predictions human pricing
NM_001134505 Rosetta Predictions rat pricing
NM_178689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00445432 predicted 2364
2 SASI_Hs02_00445433 predicted 670
3 SASI_Hs02_00445434 predicted 1387
4 SASI_Hs02_00445435 predicted 1481
5 SASI_Hs02_00445436 predicted 1695
6 SASI_Hs02_00445437 predicted 1706
7 SASI_Hs02_00445438 predicted 1465
8 SASI_Hs02_00445439 predicted 587
9 SASI_Hs02_00445440 predicted 1915
10 SASI_Hs02_00445441 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286801 predicted 2363
2 SASI_Hs01_00286804 predicted 664
3 SASI_Hs01_00286805 predicted 1382
4 SASI_Hs01_00286806 predicted 1479
5 SASI_Hs01_00286807 predicted 1684
6 SASI_Hs01_00286808 predicted 1706
7 SASI_Hs02_00479232 predicted 1463
8 SASI_Hs02_00479233 predicted 582
9 SASI_Hs02_00479234 predicted 1920
10 SASI_Hs02_00479235 predicted 1693
11 SASI_Hs01_00286800 predicted 2635
12 SASI_Hs01_00286802 predicted 553
13 SASI_Hs01_00286803 predicted 608
14 SASI_Hs01_00286809 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483873 predicted 2362
2 SASI_Hs02_00483874 predicted 666
3 SASI_Hs02_00483875 predicted 1391
4 SASI_Hs02_00483876 predicted 1487
5 SASI_Hs02_00483877 predicted 1687
6 SASI_Hs02_00483878 predicted 1714
7 SASI_Hs02_00483879 predicted 1468
8 SASI_Hs02_00483880 predicted 590
9 SASI_Hs02_00483881 predicted 1915
10 SASI_Hs02_00483882 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256539 predicted 963
2 SASI_Rn02_00256540 predicted 1318
3 SASI_Rn02_00256541 predicted 1111
4 SASI_Rn02_00256542 predicted 1917
5 SASI_Rn02_00256543 predicted 1202
6 SASI_Rn02_00256544 predicted 250
7 SASI_Rn02_00256545 predicted 1915
8 SASI_Rn02_00256546 predicted 1814
9 SASI_Rn02_00256547 predicted 341
10 SASI_Rn02_00256548 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124907 predicted 1611
2 SASI_Mm01_00124908 predicted 281
3 SASI_Mm02_00349179 predicted 1714
4 SASI_Mm01_00124909 predicted 1210
5 SASI_Mm01_00124910 predicted 1327
6 SASI_Mm01_00124911 predicted 1318
7 SASI_Mm01_00124912 predicted 930
8 SASI_Mm01_00124914 predicted 1101
9 SASI_Mm01_00124915 predicted 1803
10 SASI_Mm01_00124916 predicted 1863
11 SASI_Mm01_00124913 predicted 1538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178689
ENO4 MISSION shRNA Bacterial Glycerol Stock
enolase family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178689.2-1979s1c1
Sequence:CCGGCGCTCTGAACTCCACTTATATCTCGAGATATAAGTGGAGTTCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-848s1c1
Sequence:CCGGGCAGCCGTCAACATTCTCTATCTCGAGATAGAGAATGTTGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-799s1c1
Sequence:CCGGCCAGCGATCCTCTCTACTTAACTCGAGTTAAGTAGAGAGGATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-1565s1c1
Sequence:CCGGCCATCTTATCAACGGTAAGAACTCGAGTTCTTACCGTTGATAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-1344s1c1
Sequence:CCGGCCTTCCATAATCGCCTTAATTCTCGAGAATTAAGGCGATTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178689
ENO4 MISSION shRNA shRNA Plasmid DNA
enolase family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178689.2-1979s1c1
Sequence:CCGGCGCTCTGAACTCCACTTATATCTCGAGATATAAGTGGAGTTCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-848s1c1
Sequence:CCGGGCAGCCGTCAACATTCTCTATCTCGAGATAGAGAATGTTGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-799s1c1
Sequence:CCGGCCAGCGATCCTCTCTACTTAACTCGAGTTAAGTAGAGAGGATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-1565s1c1
Sequence:CCGGCCATCTTATCAACGGTAAGAACTCGAGTTCTTACCGTTGATAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-1344s1c1
Sequence:CCGGCCTTCCATAATCGCCTTAATTCTCGAGAATTAAGGCGATTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178689
ENO4 MISSION shRNA Lentiviral Transduction Particles
enolase family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178689.2-1979s1c1
Sequence:CCGGCGCTCTGAACTCCACTTATATCTCGAGATATAAGTGGAGTTCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-848s1c1
Sequence:CCGGGCAGCCGTCAACATTCTCTATCTCGAGATAGAGAATGTTGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-799s1c1
Sequence:CCGGCCAGCGATCCTCTCTACTTAACTCGAGTTAAGTAGAGAGGATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-1565s1c1
Sequence:CCGGCCATCTTATCAACGGTAAGAACTCGAGTTCTTACCGTTGATAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178689.2-1344s1c1
Sequence:CCGGCCTTCCATAATCGCCTTAATTCTCGAGAATTAAGGCGATTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks