EMAIL THIS PAGE TO A FRIEND

ENOPH1

enolase-phosphatase 1

86 Gene Product Result for
Synonyms: E1 MASA MST145 mtnC
UniProtKB ID: Q9UHY7, Q7Z4C5, Q9BVC2
Gene ID:
Mouse(67870) enolase-phosphatase 1
Rat(305177) enolase-phosphatase 1
Zebrafish(431773) enolase-phosphatase 1
domestic cat(101087835) enolase-phosphatase 1
cow(525563) enolase-phosphatase 1
dog(478452) enolase-phosphatase 1
chicken(422600) enolase-phosphatase 1
sheep(101114870) enolase-phosphatase 1
naked mole-rat(101721469) enolase-phosphatase 1
domestic guinea pig(100728925) enolase-phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021204 Rosetta Predictions human pricing
NM_001009391 Rosetta Predictions rat pricing
NM_026421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201157 predicted 707
2 SASI_Hs01_00201158 predicted 1054
3 SASI_Hs02_00354794 predicted 704
4 SASI_Hs01_00201159 predicted 1106
5 SASI_Hs01_00201160 predicted 693
6 SASI_Hs01_00201162 predicted 650
7 SASI_Hs01_00201163 predicted 1056
8 SASI_Hs02_00354795 predicted 774
9 SASI_Hs01_00201166 predicted 510
10 SASI_Hs02_00354796 predicted 255
11 SASI_Hs01_00201161 predicted 729
12 SASI_Hs01_00201164 predicted 1053
13 SASI_Hs01_00201165 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074116 predicted 689
2 SASI_Rn01_00074117 predicted 940
3 SASI_Rn01_00074118 predicted 701
4 SASI_Rn01_00074121 predicted 1017
5 SASI_Rn01_00074122 predicted 897
6 SASI_Rn02_00199527 predicted 1050
7 SASI_Rn02_00199528 predicted 687
8 SASI_Rn01_00074123 predicted 642
9 SASI_Rn01_00074124 predicted 364
10 SASI_Rn01_00074125 predicted 946
11 SASI_Rn01_00074119 predicted 1139
12 SASI_Rn01_00074120 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141889 predicted 1054
2 SASI_Mm01_00141891 predicted 696
3 SASI_Mm01_00141892 predicted 786
4 SASI_Mm01_00141893 predicted 1009
5 SASI_Mm01_00141894 predicted 232
6 SASI_Mm01_00141897 predicted 242
7 SASI_Mm02_00330232 predicted 488
8 SASI_Mm01_00141898 predicted 634
9 SASI_Mm02_00330233 predicted 582
10 SASI_Mm02_00330234 predicted 243
11 SASI_Mm01_00141890 predicted 1017
12 SASI_Mm01_00141895 predicted 384
13 SASI_Mm01_00141896 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021204
VALIDATED
ENOPH1 MISSION shRNA Bacterial Glycerol Stock
enolase-phosphatase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_021204.1-1435s1c1
Sequence:CCGGCCCTTGTGATTTAGAAGATTACTCGAGTAATCTTCTAAATCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021204.1-249s1c1
Sequence:CCGGGTCACCGTGATCCTGTTAGATCTCGAGATCTAACAGGATCACGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021204.1-800s1c1
Sequence:CCGGCCGAAAGATTGCAGACAGCATCTCGAGATGCTGTCTGCAATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021204.1-606s1c1
Sequence:CCGGGCAGAGTTCTTTGCAGATGTACTCGAGTACATCTGCAAAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-524s21c1
Sequence:GTACCGGGATCCAGGCCGTGGTAGATAACTCGAGTTATCTACCACGGCCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-694s21c1
Sequence:GTACCGGGAATGAAGGTGTACATCTATTCTCGAGAATAGATGTACACCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-642s21c1
Sequence:CCGGGCAGAGTTCTTTGCAGATGTACTCGAGTACATCTGCAAAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-571s21c1
Sequence:CCGGGAAAGACCACTGCACTCAAACCTCGAGGTTTGAGTGCAGTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-1473s21c1
Sequence:CCGGCCCTTGTGATTTAGAAGATTACTCGAGTAATCTTCTAAATCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-754s21c1
Sequence:CCGGATTCTACGGAGGGAGATATTCCTCGAGGAATATCTCCCTCCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-952s21c1
Sequence:CCGGGACCAGGCAACGCAGGATTAACTCGAGTTAATCCTGCGTTGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-1005s21c1
Sequence:GTACCGGACATCCTTCAGTGAACTATACCTCGAGGTATAGTTCACTGAAGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021204
VALIDATED
ENOPH1 MISSION shRNA shRNA Plasmid DNA
enolase-phosphatase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_021204.1-1435s1c1
Sequence:CCGGCCCTTGTGATTTAGAAGATTACTCGAGTAATCTTCTAAATCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021204.1-249s1c1
Sequence:CCGGGTCACCGTGATCCTGTTAGATCTCGAGATCTAACAGGATCACGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021204.1-800s1c1
Sequence:CCGGCCGAAAGATTGCAGACAGCATCTCGAGATGCTGTCTGCAATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021204.1-606s1c1
Sequence:CCGGGCAGAGTTCTTTGCAGATGTACTCGAGTACATCTGCAAAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-524s21c1
Sequence:GTACCGGGATCCAGGCCGTGGTAGATAACTCGAGTTATCTACCACGGCCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-694s21c1
Sequence:GTACCGGGAATGAAGGTGTACATCTATTCTCGAGAATAGATGTACACCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-642s21c1
Sequence:CCGGGCAGAGTTCTTTGCAGATGTACTCGAGTACATCTGCAAAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-571s21c1
Sequence:CCGGGAAAGACCACTGCACTCAAACCTCGAGGTTTGAGTGCAGTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-1473s21c1
Sequence:CCGGCCCTTGTGATTTAGAAGATTACTCGAGTAATCTTCTAAATCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-754s21c1
Sequence:CCGGATTCTACGGAGGGAGATATTCCTCGAGGAATATCTCCCTCCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-952s21c1
Sequence:CCGGGACCAGGCAACGCAGGATTAACTCGAGTTAATCCTGCGTTGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-1005s21c1
Sequence:GTACCGGACATCCTTCAGTGAACTATACCTCGAGGTATAGTTCACTGAAGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021204
VALIDATED
ENOPH1 MISSION shRNA Lentiviral Transduction Particles
enolase-phosphatase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_021204.1-1435s1c1
Sequence:CCGGCCCTTGTGATTTAGAAGATTACTCGAGTAATCTTCTAAATCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021204.1-249s1c1
Sequence:CCGGGTCACCGTGATCCTGTTAGATCTCGAGATCTAACAGGATCACGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021204.1-800s1c1
Sequence:CCGGCCGAAAGATTGCAGACAGCATCTCGAGATGCTGTCTGCAATCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021204.1-606s1c1
Sequence:CCGGGCAGAGTTCTTTGCAGATGTACTCGAGTACATCTGCAAAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-524s21c1
Sequence:GTACCGGGATCCAGGCCGTGGTAGATAACTCGAGTTATCTACCACGGCCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-694s21c1
Sequence:GTACCGGGAATGAAGGTGTACATCTATTCTCGAGAATAGATGTACACCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-642s21c1
Sequence:CCGGGCAGAGTTCTTTGCAGATGTACTCGAGTACATCTGCAAAGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-571s21c1
Sequence:CCGGGAAAGACCACTGCACTCAAACCTCGAGGTTTGAGTGCAGTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-1473s21c1
Sequence:CCGGCCCTTGTGATTTAGAAGATTACTCGAGTAATCTTCTAAATCACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-754s21c1
Sequence:CCGGATTCTACGGAGGGAGATATTCCTCGAGGAATATCTCCCTCCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-952s21c1
Sequence:CCGGGACCAGGCAACGCAGGATTAACTCGAGTTAATCCTGCGTTGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021204.3-1005s21c1
Sequence:GTACCGGACATCCTTCAGTGAACTATACCTCGAGGTATAGTTCACTGAAGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026421
VALIDATED
ENOPH1 MISSION shRNA Bacterial Glycerol Stock
enolase-phosphatase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026421.1-919s1c1
Sequence:CCGGCGACGAGAAGACATACTACAACTCGAGTTGTAGTATGTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-796s1c1
Sequence:CCGGCATCGGTTGTTCAACCAACAACTCGAGTTGTTGGTTGAACAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-799s1c1
Sequence:CCGGCGGTTGTTCAACCAACAACATCTCGAGATGTTGTTGGTTGAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-275s1c1
Sequence:CCGGCCGATTGCTTTCGTGAAGGATCTCGAGATCCTTCACGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026421.1-1140s1c1
Sequence:CCGGCCGTTCCATGAAGACCAAATTCTCGAGAATTTGGTCTTCATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-255s21c1
Sequence:CCGGCACCGTAATCCTGTTAGATATCTCGAGATATCTAACAGGATTACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-530s21c1
Sequence:CCGGGAAAGACCACAGCGCTCAAACCTCGAGGTTTGAGCGCTGTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.2-916s21c1
Sequence:CCGGCGACGAGAAGACATACTACAACTCGAGTTGTAGTATGTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026421.2-1137s21c1
Sequence:CCGGCCGTTCCATGAAGACCAAATTCTCGAGAATTTGGTCTTCATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-737s21c1
Sequence:CCGGAGCTCATCGACGGTCACTTTGCTCGAGCAAAGTGACCGTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026421
VALIDATED
ENOPH1 MISSION shRNA shRNA Plasmid DNA
enolase-phosphatase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026421.1-919s1c1
Sequence:CCGGCGACGAGAAGACATACTACAACTCGAGTTGTAGTATGTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-796s1c1
Sequence:CCGGCATCGGTTGTTCAACCAACAACTCGAGTTGTTGGTTGAACAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-799s1c1
Sequence:CCGGCGGTTGTTCAACCAACAACATCTCGAGATGTTGTTGGTTGAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-275s1c1
Sequence:CCGGCCGATTGCTTTCGTGAAGGATCTCGAGATCCTTCACGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026421.1-1140s1c1
Sequence:CCGGCCGTTCCATGAAGACCAAATTCTCGAGAATTTGGTCTTCATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-255s21c1
Sequence:CCGGCACCGTAATCCTGTTAGATATCTCGAGATATCTAACAGGATTACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-530s21c1
Sequence:CCGGGAAAGACCACAGCGCTCAAACCTCGAGGTTTGAGCGCTGTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.2-916s21c1
Sequence:CCGGCGACGAGAAGACATACTACAACTCGAGTTGTAGTATGTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026421.2-1137s21c1
Sequence:CCGGCCGTTCCATGAAGACCAAATTCTCGAGAATTTGGTCTTCATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-737s21c1
Sequence:CCGGAGCTCATCGACGGTCACTTTGCTCGAGCAAAGTGACCGTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026421
VALIDATED
ENOPH1 MISSION shRNA Lentiviral Transduction Particles
enolase-phosphatase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026421.1-919s1c1
Sequence:CCGGCGACGAGAAGACATACTACAACTCGAGTTGTAGTATGTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-796s1c1
Sequence:CCGGCATCGGTTGTTCAACCAACAACTCGAGTTGTTGGTTGAACAACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-799s1c1
Sequence:CCGGCGGTTGTTCAACCAACAACATCTCGAGATGTTGTTGGTTGAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026421.1-275s1c1
Sequence:CCGGCCGATTGCTTTCGTGAAGGATCTCGAGATCCTTCACGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026421.1-1140s1c1
Sequence:CCGGCCGTTCCATGAAGACCAAATTCTCGAGAATTTGGTCTTCATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-255s21c1
Sequence:CCGGCACCGTAATCCTGTTAGATATCTCGAGATATCTAACAGGATTACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-530s21c1
Sequence:CCGGGAAAGACCACAGCGCTCAAACCTCGAGGTTTGAGCGCTGTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.2-916s21c1
Sequence:CCGGCGACGAGAAGACATACTACAACTCGAGTTGTAGTATGTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026421.2-1137s21c1
Sequence:CCGGCCGTTCCATGAAGACCAAATTCTCGAGAATTTGGTCTTCATGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026421.3-737s21c1
Sequence:CCGGAGCTCATCGACGGTCACTTTGCTCGAGCAAAGTGACCGTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks