EMAIL THIS PAGE TO A FRIEND

ENOSF1

enolase superfamily member 1

41 Gene Product Result for
Synonyms: HSRTSBETA RTS TYMSAS
Gene ID:
Human(55556) Summary: This gene was originally identified as a naturally occurring antisense transcript to the human thymidylate synthase gene. Alternate splice variants have been described, one of which (named rTSalpha) represents an alternate 3'UTR that is complementary to the 3'UTR and terminal intron of the thymidylate synthase (TS) RNA and down-regulates TS expression. Other transcript variants (rTSbeta and rTSgamma) do not overlap the TS locus. The function of this gene appears to be primarily to regulate expression of the TS locus both via the antisense transcript as well as through the encoded proteins. [provided by RefSeq, Mar 2010]
Zebrafish(558186) enolase superfamily member 1
cow(615106) enolase superfamily member 1
domestic cat(101090970) enolase superfamily member 1
dog(480185) enolase superfamily member 1
domestic guinea pig(100720806) enolase superfamily member 1
naked mole-rat(101721621) enolase superfamily member 1
sheep(101104113) enolase superfamily member 1
Domestic Rabbit(100341613) enolase superfamily member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017512 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088081 MISSION® esiRNA esiRNA human ENOSF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126123 Rosetta Predictions human pricing
NM_017512 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328287 predicted 851
2 SASI_Hs02_00328288 predicted 1063
3 SASI_Hs02_00328289 predicted 664
4 SASI_Hs02_00328290 predicted 679
5 SASI_Hs02_00328291 predicted 1200
6 SASI_Hs02_00328292 predicted 670
7 SASI_Hs02_00328293 predicted 976
8 SASI_Hs02_00328294 predicted 701
9 SASI_Hs02_00328295 predicted 1165
10 SASI_Hs02_00328296 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350125 predicted 964
2 SASI_Hs02_00350126 predicted 1186
3 SASI_Hs01_00220976 predicted 789
4 SASI_Hs01_00220979 predicted 799
5 SASI_Hs02_00350127 predicted 1325
6 SASI_Hs02_00350128 predicted 777
7 SASI_Hs01_00220980 predicted 1090
8 SASI_Hs02_00350129 predicted 817
9 SASI_Hs02_00350130 predicted 1274
10 SASI_Hs02_00350131 predicted 1319
11 SASI_Hs01_00220972 predicted 237
12 SASI_Hs01_00220973 predicted 305
13 SASI_Hs01_00220974 predicted 1335
14 SASI_Hs01_00220975 predicted 1357
15 SASI_Hs01_00220977 predicted 563
16 SASI_Hs01_00220978 predicted 557
17 SASI_Hs01_00220981 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017512
VALIDATED
ENOSF1 MISSION shRNA Bacterial Glycerol Stock
enolase superfamily member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-995s21c1
Sequence:CCGGGCCACAATAGAGTGATATTTACTCGAGTAAATATCACTCTATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-1534s21c1
Sequence:CCGGCCCTCAGGAATCAGCTAAGTACTCGAGTACTTAGCTGATTCCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-1311s21c1
Sequence:CCGGCGGCTACTCAACAGAAATGAACTCGAGTTCATTTCTGTTGAGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-510s21c1
Sequence:CCGGGCTGGTATCCTGCATAGATTTCTCGAGAAATCTATGCAGGATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-1514s1c1
Sequence:CCGGCCCTCAGGAATCAGCTAAGTACTCGAGTACTTAGCTGATTCCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-975s1c1
Sequence:CCGGGCCACAATAGAGTGATATTTACTCGAGTAAATATCACTCTATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-1291s1c1
Sequence:CCGGCGGCTACTCAACAGAAATGAACTCGAGTTCATTTCTGTTGAGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-973s1c1
Sequence:CCGGGTGCCACAATAGAGTGATATTCTCGAGAATATCACTCTATTGTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-490s1c1
Sequence:CCGGGCTGGTATCCTGCATAGATTTCTCGAGAAATCTATGCAGGATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017512
VALIDATED
ENOSF1 MISSION shRNA shRNA Plasmid DNA
enolase superfamily member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-995s21c1
Sequence:CCGGGCCACAATAGAGTGATATTTACTCGAGTAAATATCACTCTATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-1534s21c1
Sequence:CCGGCCCTCAGGAATCAGCTAAGTACTCGAGTACTTAGCTGATTCCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-1311s21c1
Sequence:CCGGCGGCTACTCAACAGAAATGAACTCGAGTTCATTTCTGTTGAGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-510s21c1
Sequence:CCGGGCTGGTATCCTGCATAGATTTCTCGAGAAATCTATGCAGGATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-1514s1c1
Sequence:CCGGCCCTCAGGAATCAGCTAAGTACTCGAGTACTTAGCTGATTCCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-975s1c1
Sequence:CCGGGCCACAATAGAGTGATATTTACTCGAGTAAATATCACTCTATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-1291s1c1
Sequence:CCGGCGGCTACTCAACAGAAATGAACTCGAGTTCATTTCTGTTGAGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-973s1c1
Sequence:CCGGGTGCCACAATAGAGTGATATTCTCGAGAATATCACTCTATTGTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-490s1c1
Sequence:CCGGGCTGGTATCCTGCATAGATTTCTCGAGAAATCTATGCAGGATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017512
VALIDATED
ENOSF1 MISSION shRNA Lentiviral Transduction Particles
enolase superfamily member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-995s21c1
Sequence:CCGGGCCACAATAGAGTGATATTTACTCGAGTAAATATCACTCTATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-1534s21c1
Sequence:CCGGCCCTCAGGAATCAGCTAAGTACTCGAGTACTTAGCTGATTCCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-1311s21c1
Sequence:CCGGCGGCTACTCAACAGAAATGAACTCGAGTTCATTTCTGTTGAGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017512.4-510s21c1
Sequence:CCGGGCTGGTATCCTGCATAGATTTCTCGAGAAATCTATGCAGGATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-1514s1c1
Sequence:CCGGCCCTCAGGAATCAGCTAAGTACTCGAGTACTTAGCTGATTCCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-975s1c1
Sequence:CCGGGCCACAATAGAGTGATATTTACTCGAGTAAATATCACTCTATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-1291s1c1
Sequence:CCGGCGGCTACTCAACAGAAATGAACTCGAGTTCATTTCTGTTGAGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-973s1c1
Sequence:CCGGGTGCCACAATAGAGTGATATTCTCGAGAATATCACTCTATTGTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017512.2-490s1c1
Sequence:CCGGGCTGGTATCCTGCATAGATTTCTCGAGAAATCTATGCAGGATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)