EMAIL THIS PAGE TO A FRIEND

ENOX1

ecto-NOX disulfide-thiol exchanger 1

73 Gene Product Result for
Synonyms: CNOX PIG38 bA64J21.1 cCNOX
UniProtKB ID: Q8TC92, A4GU15, A6NMH9, Q2TU81, Q5VT11, Q9NWE0
Gene ID:
Human(55068) Summary: Electron transport pathways are generally associated with mitochondrial membranes, but non-mitochondrial pathways are also biologically significant. Plasma membrane electron transport pathways are involved in functions as diverse as cellular defense, intracellular redox homeostasis, and control of cell growth and survival. Members of the ecto-NOX family, such as CNOX, or ENOX1, are involved in plasma membrane transport pathways. These enzymes exhibit both a hydroquinone (NADH) oxidase activity and a protein disulfide-thiol interchange activity in series, with each activity cycling every 22 to 26 minutes (Scarlett et al., 2005 [PubMed 15882838]
Mouse(239188) ecto-NOX disulfide-thiol exchanger 1
Rat(306038) ecto-NOX disulfide-thiol exchanger 1
sheep(101102318) ecto-NOX disulfide-thiol exchanger 1
naked mole-rat(101723684) ecto-NOX disulfide-thiol exchanger 1
domestic guinea pig(100714058) ecto-NOX disulfide-thiol exchanger 1
Zebrafish(100002220) ecto-NOX disulfide-thiol exchanger 1
domestic cat(101089320) ecto-NOX disulfide-thiol exchanger 1
cow(615969) ecto-NOX disulfide-thiol exchanger 1
Horse(100060057) ecto-NOX disulfide-thiol exchanger 1
dog(609336) ecto-NOX disulfide-thiol exchanger 1
chicken(418839) ecto-NOX disulfide-thiol exchanger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127615 Rosetta Predictions human pricing
NM_017993 Rosetta Predictions human pricing
XM_224366 Rosetta Predictions rat pricing
NM_172813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329884 predicted 875
2 SASI_Hs02_00329885 predicted 2232
3 SASI_Hs02_00329886 predicted 616
4 SASI_Hs02_00329887 predicted 846
5 SASI_Hs02_00329888 predicted 524
6 SASI_Hs02_00329889 predicted 796
7 SASI_Hs02_00329890 predicted 885
8 SASI_Hs02_00329891 predicted 2187
9 SASI_Hs02_00329892 predicted 2053
10 SASI_Hs02_00329893 predicted 1985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158106 predicted 1209
2 SASI_Hs01_00158107 predicted 2574
3 SASI_Hs01_00158108 predicted 951
4 SASI_Hs01_00158109 predicted 1189
5 SASI_Hs01_00158110 predicted 860
6 SASI_Hs01_00158111 predicted 1136
7 SASI_Hs01_00158112 predicted 1225
8 SASI_Hs02_00351045 predicted 2524
9 SASI_Hs01_00158113 predicted 2396
10 SASI_Hs01_00158115 predicted 2329
11 SASI_Hs01_00158114 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381929 predicted 2177
2 SASI_Rn02_00381930 predicted 2282
3 SASI_Rn02_00381931 predicted 2038
4 SASI_Rn02_00381932 predicted 2322
5 SASI_Rn02_00381933 predicted 2007
6 SASI_Rn02_00381934 predicted 2143
7 SASI_Rn02_00381935 predicted 2083
8 SASI_Rn02_00381936 predicted 2343
9 SASI_Rn02_00381937 predicted 2316
10 SASI_Rn02_00381938 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174961 predicted 2586
2 SASI_Mm02_00344737 predicted 1244
3 SASI_Mm01_00174963 predicted 1186
4 SASI_Mm01_00174964 predicted 2497
5 SASI_Mm01_00174965 predicted 2481
6 SASI_Mm01_00174966 predicted 2192
7 SASI_Mm01_00174967 predicted 2370
8 SASI_Mm01_00174968 predicted 1205
9 SASI_Mm02_00344738 predicted 1157
10 SASI_Mm01_00174969 predicted 2398
11 SASI_Mm01_00174962 predicted 2306
12 SASI_Mm01_00174970 predicted 2451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017993
VALIDATED
ENOX1 MISSION shRNA Bacterial Glycerol Stock
ecto-NOX disulfide-thiol exchanger 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017993.1-2446s1c1
Sequence:CCGGCCACAGTCATAATGATGGCAACTCGAGTTGCCATCATTATGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017993.1-1375s1c1
Sequence:CCGGCAGCGCAAGAACATAGACATTCTCGAGAATGTCTATGTTCTTGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017993.1-1374s1c1
Sequence:CCGGCCAGCGCAAGAACATAGACATCTCGAGATGTCTATGTTCTTGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017993.1-1972s1c1
Sequence:CCGGGCTCTGCTAATAGGTATCATACTCGAGTATGATACCTATTAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017993.1-1731s1c1
Sequence:CCGGCCAGGAGGAGTTAAACAACAACTCGAGTTGTTGTTTAACTCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2685s21c1
Sequence:CCGGTCGAAGCCTGCCTTTAGTTATCTCGAGATAACTAAAGGCAGGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1125s21c1
Sequence:CCGGTTGAACAGTGCGGTGATATTACTCGAGTAATATCACCGCACTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1067s21c1
Sequence:CCGGACCGTGTTTGTCGGAGGATTACTCGAGTAATCCTCCGACAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1746s21c1
Sequence:CCGGAGCGCAAGAACATAGACATTTCTCGAGAAATGTCTATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2158s21c1
Sequence:CCGGCCATACACAAGCGTTACTAAACTCGAGTTTAGTAACGCTTGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2231s21c1
Sequence:CCGGCACAGCCATGAGGATTCAAATCTCGAGATTTGAATCCTCATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017993
VALIDATED
ENOX1 MISSION shRNA shRNA Plasmid DNA
ecto-NOX disulfide-thiol exchanger 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017993.1-2446s1c1
Sequence:CCGGCCACAGTCATAATGATGGCAACTCGAGTTGCCATCATTATGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017993.1-1375s1c1
Sequence:CCGGCAGCGCAAGAACATAGACATTCTCGAGAATGTCTATGTTCTTGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017993.1-1374s1c1
Sequence:CCGGCCAGCGCAAGAACATAGACATCTCGAGATGTCTATGTTCTTGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017993.1-1972s1c1
Sequence:CCGGGCTCTGCTAATAGGTATCATACTCGAGTATGATACCTATTAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017993.1-1731s1c1
Sequence:CCGGCCAGGAGGAGTTAAACAACAACTCGAGTTGTTGTTTAACTCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2685s21c1
Sequence:CCGGTCGAAGCCTGCCTTTAGTTATCTCGAGATAACTAAAGGCAGGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1125s21c1
Sequence:CCGGTTGAACAGTGCGGTGATATTACTCGAGTAATATCACCGCACTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1067s21c1
Sequence:CCGGACCGTGTTTGTCGGAGGATTACTCGAGTAATCCTCCGACAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1746s21c1
Sequence:CCGGAGCGCAAGAACATAGACATTTCTCGAGAAATGTCTATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2158s21c1
Sequence:CCGGCCATACACAAGCGTTACTAAACTCGAGTTTAGTAACGCTTGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2231s21c1
Sequence:CCGGCACAGCCATGAGGATTCAAATCTCGAGATTTGAATCCTCATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017993
VALIDATED
ENOX1 MISSION shRNA Lentiviral Transduction Particles
ecto-NOX disulfide-thiol exchanger 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017993.1-2446s1c1
Sequence:CCGGCCACAGTCATAATGATGGCAACTCGAGTTGCCATCATTATGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017993.1-1375s1c1
Sequence:CCGGCAGCGCAAGAACATAGACATTCTCGAGAATGTCTATGTTCTTGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017993.1-1374s1c1
Sequence:CCGGCCAGCGCAAGAACATAGACATCTCGAGATGTCTATGTTCTTGCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017993.1-1972s1c1
Sequence:CCGGGCTCTGCTAATAGGTATCATACTCGAGTATGATACCTATTAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017993.1-1731s1c1
Sequence:CCGGCCAGGAGGAGTTAAACAACAACTCGAGTTGTTGTTTAACTCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2685s21c1
Sequence:CCGGTCGAAGCCTGCCTTTAGTTATCTCGAGATAACTAAAGGCAGGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1125s21c1
Sequence:CCGGTTGAACAGTGCGGTGATATTACTCGAGTAATATCACCGCACTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1067s21c1
Sequence:CCGGACCGTGTTTGTCGGAGGATTACTCGAGTAATCCTCCGACAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-1746s21c1
Sequence:CCGGAGCGCAAGAACATAGACATTTCTCGAGAAATGTCTATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2158s21c1
Sequence:CCGGCCATACACAAGCGTTACTAAACTCGAGTTTAGTAACGCTTGTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017993.2-2231s21c1
Sequence:CCGGCACAGCCATGAGGATTCAAATCTCGAGATTTGAATCCTCATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172813
ENOX1 MISSION shRNA Bacterial Glycerol Stock
ecto-NOX disulfide-thiol exchanger 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-2535s1c1
Sequence:CCGGCCACGGATGTTCAAACAGGAACTCGAGTTCCTGTTTGAACATCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-1670s1c1
Sequence:CCGGGCAGGAAATGGAGGAAGCAAACTCGAGTTTGCTTCCTCCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-1028s1c1
Sequence:CCGGCAAGGAAATAATCCACTGCAACTCGAGTTGCAGTGGATTATTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-1280s21c1
Sequence:CCGGTCTGGTTACAGAATGCGATTACTCGAGTAATCGCATTCTGTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172813.2-2829s21c1
Sequence:CCGGCCAGACCTGTCCCTATGAATACTCGAGTATTCATAGGGACAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-2317s21c1
Sequence:CCGGGTTGACGGTCGCGTTGGTTAACTCGAGTTAACCAACGCGACCGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-2597s21c1
Sequence:CCGGTGTGCCTTTGAAGGAATTAAACTCGAGTTTAATTCCTTCAAAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-1800s21c1
Sequence:CCGGAGCGCAAGAACATAGACATTTCTCGAGAAATGTCTATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172813
ENOX1 MISSION shRNA shRNA Plasmid DNA
ecto-NOX disulfide-thiol exchanger 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-2535s1c1
Sequence:CCGGCCACGGATGTTCAAACAGGAACTCGAGTTCCTGTTTGAACATCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-1670s1c1
Sequence:CCGGGCAGGAAATGGAGGAAGCAAACTCGAGTTTGCTTCCTCCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-1028s1c1
Sequence:CCGGCAAGGAAATAATCCACTGCAACTCGAGTTGCAGTGGATTATTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-1280s21c1
Sequence:CCGGTCTGGTTACAGAATGCGATTACTCGAGTAATCGCATTCTGTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172813.2-2829s21c1
Sequence:CCGGCCAGACCTGTCCCTATGAATACTCGAGTATTCATAGGGACAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-2317s21c1
Sequence:CCGGGTTGACGGTCGCGTTGGTTAACTCGAGTTAACCAACGCGACCGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-2597s21c1
Sequence:CCGGTGTGCCTTTGAAGGAATTAAACTCGAGTTTAATTCCTTCAAAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-1800s21c1
Sequence:CCGGAGCGCAAGAACATAGACATTTCTCGAGAAATGTCTATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172813
ENOX1 MISSION shRNA Lentiviral Transduction Particles
ecto-NOX disulfide-thiol exchanger 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-2535s1c1
Sequence:CCGGCCACGGATGTTCAAACAGGAACTCGAGTTCCTGTTTGAACATCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-1670s1c1
Sequence:CCGGGCAGGAAATGGAGGAAGCAAACTCGAGTTTGCTTCCTCCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172813.1-1028s1c1
Sequence:CCGGCAAGGAAATAATCCACTGCAACTCGAGTTGCAGTGGATTATTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-1280s21c1
Sequence:CCGGTCTGGTTACAGAATGCGATTACTCGAGTAATCGCATTCTGTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172813.2-2829s21c1
Sequence:CCGGCCAGACCTGTCCCTATGAATACTCGAGTATTCATAGGGACAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-2317s21c1
Sequence:CCGGGTTGACGGTCGCGTTGGTTAACTCGAGTTAACCAACGCGACCGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-2597s21c1
Sequence:CCGGTGTGCCTTTGAAGGAATTAAACTCGAGTTTAATTCCTTCAAAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172813.2-1800s21c1
Sequence:CCGGAGCGCAAGAACATAGACATTTCTCGAGAAATGTCTATGTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks