EMAIL THIS PAGE TO A FRIEND

ENOX2

ecto-NOX disulfide-thiol exchanger 2

177 Gene Product Result for
Synonyms: APK1 COVA1 tNOX
Gene ID:
Human(10495) Summary: The protein encoded by this gene is a growth-related cell surface protein. It was identifed because it reacts with the monoclonal antibody KI in cells, such as the ovarian carcinoma line OVCAR-3, also expressing the CAKI surface glycoprotein. The encoded protein has two enzymatic activities: catalysis of hydroquinone or NADH oxidation, and protein disulfide interchange. The two activities alternate with a period length of about 24 minutes. The encoded protein also displays prion-like properties. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(209224) ecto-NOX disulfide-thiol exchanger 2
Rat(302817) ecto-NOX disulfide-thiol exchanger 2
Zebrafish(566327) ecto-NOX disulfide-thiol exchanger 2
chicken(422142) ecto-NOX disulfide-thiol exchanger 2
domestic cat(101083495) ecto-NOX disulfide-thiol exchanger 2
Horse(100058391) ecto-NOX disulfide-thiol exchanger 2
dog(481050) ecto-NOX disulfide-thiol exchanger 2
cow(100336550) ecto-NOX disulfide-thiol exchanger 2
domestic guinea pig(100728927) ecto-NOX disulfide-thiol exchanger 2
naked mole-rat(101704048) ecto-NOX disulfide-thiol exchanger 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062811 MISSION® esiRNA esiRNA human ENOX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006375 Rosetta Predictions human pricing
NM_182314 Rosetta Predictions human pricing
XM_001060535 Rosetta Predictions rat pricing
XM_229131 Rosetta Predictions rat pricing
NM_145951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150418 predicted 1998
2 SASI_Hs01_00150419 predicted 849
3 SASI_Hs01_00150420 predicted 960
4 SASI_Hs01_00150421 predicted 780
5 SASI_Hs01_00150423 predicted 1870
6 SASI_Hs02_00341435 predicted 1431
7 SASI_Hs01_00150424 predicted 1859
8 SASI_Hs01_00150425 predicted 687
9 SASI_Hs01_00150426 predicted 2155
10 SASI_Hs01_00150427 predicted 713
11 SASI_Hs01_00150422 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144859 predicted 2089
2 SASI_Hs01_00144860 predicted 934
3 SASI_Hs01_00144861 predicted 1047
4 SASI_Hs01_00144862 predicted 869
5 SASI_Hs01_00144864 predicted 1961
6 SASI_Hs02_00370482 predicted 1521
7 SASI_Hs01_00144865 predicted 1944
8 SASI_Hs01_00144866 predicted 778
9 SASI_Hs01_00144867 predicted 2240
10 SASI_Hs01_00144868 predicted 799
11 SASI_Hs01_00144863 predicted 2301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296902 predicted 1943
2 SASI_Rn02_00296903 predicted 457
3 SASI_Rn02_00296904 predicted 536
4 SASI_Rn02_00296905 predicted 722
5 SASI_Rn02_00296906 predicted 422
6 SASI_Rn02_00296907 predicted 784
7 SASI_Rn02_00296908 predicted 1475
8 SASI_Rn02_00296909 predicted 1246
9 SASI_Rn02_00296910 predicted 996
10 SASI_Rn02_00296911 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385810 predicted 1942
2 SASI_Rn02_00385811 predicted 456
3 SASI_Rn02_00385812 predicted 535
4 SASI_Rn02_00385813 predicted 723
5 SASI_Rn02_00385814 predicted 414
6 SASI_Rn02_00385815 predicted 788
7 SASI_Rn02_00385816 predicted 1482
8 SASI_Rn02_00385817 predicted 1242
9 SASI_Rn02_00385818 predicted 995
10 SASI_Rn02_00385819 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103065 predicted 395
2 SASI_Mm01_00103066 predicted 2035
3 SASI_Mm01_00103067 predicted 1818
4 SASI_Mm01_00103068 predicted 1700
5 SASI_Mm01_00103069 predicted 1948
6 SASI_Mm02_00341417 predicted 2212
7 SASI_Mm02_00341418 predicted 1157
8 SASI_Mm01_00103070 predicted 1915
9 SASI_Mm01_00103071 predicted 972
10 SASI_Mm01_00103072 predicted 513
11 SASI_Mm01_00103064 predicted 1779
12 SASI_Mm01_00103073 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182314
VALIDATED
ENOX2 MISSION shRNA Bacterial Glycerol Stock
ecto-NOX disulfide-thiol exchanger 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-455s21c1
Sequence:CCGGATAGGCTATGCAGCCGATAACCTCGAGGTTATCGGCTGCATAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-1261s21c1
Sequence:CCGGCAACCGTCGTAGCGCCAATAACTCGAGTTATTGGCGCTACGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182314.1-3854s21c1
Sequence:CCGGAGCAGGAAGCTCAGGTTAATTCTCGAGAATTAACCTGAGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-1989s21c1
Sequence:CCGGTGAACAGCAGTCCTATCAAATCTCGAGATTTGATAGGACTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-691s21c1
Sequence:CCGGTCCAGATATGCCAGTAGTAAACTCGAGTTTACTACTGGCATATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-1526s1c1
Sequence:CCGGCGCAACATTCATAATGATGAACTCGAGTTCATCATTATGAATGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182314.1-469s1c1
Sequence:CCGGCGATAACAGTAGAACTCTGAACTCGAGTTCAGAGTTCTACTGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182314.1-2000s1c1
Sequence:CCGGCCTATCAAATCTGAACGTGAACTCGAGTTCACGTTCAGATTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-539s1c1
Sequence:CCGGGCCACAGCAATGAATAATCTTCTCGAGAAGATTATTCATTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-1273s1c1
Sequence:CCGGCGCCAATAACTTCTACTCCATCTCGAGATGGAGTAGAAGTTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182314
VALIDATED
ENOX2 MISSION shRNA shRNA Plasmid DNA
ecto-NOX disulfide-thiol exchanger 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-455s21c1
Sequence:CCGGATAGGCTATGCAGCCGATAACCTCGAGGTTATCGGCTGCATAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-1261s21c1
Sequence:CCGGCAACCGTCGTAGCGCCAATAACTCGAGTTATTGGCGCTACGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182314.1-3854s21c1
Sequence:CCGGAGCAGGAAGCTCAGGTTAATTCTCGAGAATTAACCTGAGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-1989s21c1
Sequence:CCGGTGAACAGCAGTCCTATCAAATCTCGAGATTTGATAGGACTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-691s21c1
Sequence:CCGGTCCAGATATGCCAGTAGTAAACTCGAGTTTACTACTGGCATATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-1526s1c1
Sequence:CCGGCGCAACATTCATAATGATGAACTCGAGTTCATCATTATGAATGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182314.1-469s1c1
Sequence:CCGGCGATAACAGTAGAACTCTGAACTCGAGTTCAGAGTTCTACTGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182314.1-2000s1c1
Sequence:CCGGCCTATCAAATCTGAACGTGAACTCGAGTTCACGTTCAGATTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-539s1c1
Sequence:CCGGGCCACAGCAATGAATAATCTTCTCGAGAAGATTATTCATTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-1273s1c1
Sequence:CCGGCGCCAATAACTTCTACTCCATCTCGAGATGGAGTAGAAGTTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182314
VALIDATED
ENOX2 MISSION shRNA Lentiviral Transduction Particles
ecto-NOX disulfide-thiol exchanger 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-455s21c1
Sequence:CCGGATAGGCTATGCAGCCGATAACCTCGAGGTTATCGGCTGCATAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-1261s21c1
Sequence:CCGGCAACCGTCGTAGCGCCAATAACTCGAGTTATTGGCGCTACGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182314.1-3854s21c1
Sequence:CCGGAGCAGGAAGCTCAGGTTAATTCTCGAGAATTAACCTGAGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-1989s21c1
Sequence:CCGGTGAACAGCAGTCCTATCAAATCTCGAGATTTGATAGGACTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182314.1-691s21c1
Sequence:CCGGTCCAGATATGCCAGTAGTAAACTCGAGTTTACTACTGGCATATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-1526s1c1
Sequence:CCGGCGCAACATTCATAATGATGAACTCGAGTTCATCATTATGAATGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182314.1-469s1c1
Sequence:CCGGCGATAACAGTAGAACTCTGAACTCGAGTTCAGAGTTCTACTGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182314.1-2000s1c1
Sequence:CCGGCCTATCAAATCTGAACGTGAACTCGAGTTCACGTTCAGATTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-539s1c1
Sequence:CCGGGCCACAGCAATGAATAATCTTCTCGAGAAGATTATTCATTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_182314.1-1273s1c1
Sequence:CCGGCGCCAATAACTTCTACTCCATCTCGAGATGGAGTAGAAGTTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145951
VALIDATED
ENOX2 MISSION shRNA Bacterial Glycerol Stock
ecto-NOX disulfide-thiol exchanger 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145951.2-2222s1c1
Sequence:CCGGGCTTTCAATTTGTCAGTTCATCTCGAGATGAACTGACAAATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145951.2-1951s1c1
Sequence:CCGGGCTACCAAATACCCAGCAAATCTCGAGATTTGCTGGGTATTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145951.2-1147s1c1
Sequence:CCGGGCCTGGTAAATGAGAAAGCTACTCGAGTAGCTTTCTCATTTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145951.2-1338s1c1
Sequence:CCGGGCTGAGGAAATTCGCAACATTCTCGAGAATGTTGCGAATTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145951.2-440s1c1
Sequence:CCGGCCTTGGGATGATGACTGGAATCTCGAGATTCCAGTCATCATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145951
VALIDATED
ENOX2 MISSION shRNA shRNA Plasmid DNA
ecto-NOX disulfide-thiol exchanger 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145951.2-2222s1c1
Sequence:CCGGGCTTTCAATTTGTCAGTTCATCTCGAGATGAACTGACAAATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145951.2-1951s1c1
Sequence:CCGGGCTACCAAATACCCAGCAAATCTCGAGATTTGCTGGGTATTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145951.2-1147s1c1
Sequence:CCGGGCCTGGTAAATGAGAAAGCTACTCGAGTAGCTTTCTCATTTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145951.2-1338s1c1
Sequence:CCGGGCTGAGGAAATTCGCAACATTCTCGAGAATGTTGCGAATTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145951.2-440s1c1
Sequence:CCGGCCTTGGGATGATGACTGGAATCTCGAGATTCCAGTCATCATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145951
VALIDATED
ENOX2 MISSION shRNA Lentiviral Transduction Particles
ecto-NOX disulfide-thiol exchanger 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145951.2-2222s1c1
Sequence:CCGGGCTTTCAATTTGTCAGTTCATCTCGAGATGAACTGACAAATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145951.2-1951s1c1
Sequence:CCGGGCTACCAAATACCCAGCAAATCTCGAGATTTGCTGGGTATTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145951.2-1147s1c1
Sequence:CCGGGCCTGGTAAATGAGAAAGCTACTCGAGTAGCTTTCTCATTTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145951.2-1338s1c1
Sequence:CCGGGCTGAGGAAATTCGCAACATTCTCGAGAATGTTGCGAATTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145951.2-440s1c1
Sequence:CCGGCCTTGGGATGATGACTGGAATCTCGAGATTCCAGTCATCATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks