EMAIL THIS PAGE TO A FRIEND

ENPEP

glutamyl aminopeptidase (aminopeptidase A)

Synonyms: APA CD249 gp160
UniProtKB ID: Q07075, Q504U2
Gene ID:
Mouse(13809) glutamyl aminopeptidase
Rat(64017) glutamyl aminopeptidase
Zebrafish(504088) glutamyl aminopeptidase
chicken(428771) glutamyl aminopeptidase (aminopeptidase A)
domestic cat(101082308) glutamyl aminopeptidase (aminopeptidase A)
cow(504350) glutamyl aminopeptidase (aminopeptidase A)
dog(478517) glutamyl aminopeptidase (aminopeptidase A)
sheep(101117763) glutamyl aminopeptidase (aminopeptidase A)
naked mole-rat(101721942) glutamyl aminopeptidase (aminopeptidase A)
domestic guinea pig(100715307) glutamyl aminopeptidase (aminopeptidase A)
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001977 Rosetta Predictions human pricing
NM_022251 Rosetta Predictions rat pricing
XM_001080308 Rosetta Predictions rat pricing
NM_007934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078232 predicted 2675
2 SASI_Hs01_00078233 predicted 372
3 SASI_Hs02_00332949 predicted 2523
4 SASI_Hs01_00078234 predicted 3259
5 SASI_Hs02_00332950 predicted 2420
6 SASI_Hs01_00078235 predicted 2437
7 SASI_Hs01_00078237 predicted 356
8 SASI_Hs01_00078238 predicted 2888
9 SASI_Hs01_00078239 predicted 1836
10 SASI_Hs01_00078240 predicted 2553
11 SASI_Hs01_00078236 predicted 1895
12 SASI_Hs01_00078241 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263036 predicted 2286
2 SASI_Rn01_00107189 predicted 2393
3 SASI_Rn02_00263037 predicted 2711
4 SASI_Rn01_00107192 predicted 2032
5 SASI_Rn01_00107193 predicted 2171
6 SASI_Rn02_00263038 predicted 440
7 SASI_Rn01_00107194 predicted 501
8 SASI_Rn01_00107195 predicted 1112
9 SASI_Rn02_00263039 predicted 2486
10 SASI_Rn02_00263040 predicted 2869
11 SASI_Rn01_00107187 predicted 1358
12 SASI_Rn01_00107188 predicted 1279
13 SASI_Rn01_00107190 predicted 2969
14 SASI_Rn01_00107191 predicted 1486
15 SASI_Rn01_00107196 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367537 predicted 202
2 SASI_Rn02_00367538 predicted 256
3 SASI_Rn02_00367539 predicted 306
4 SASI_Rn02_00367540 predicted 385
5 SASI_Rn02_00367541 predicted 379
6 SASI_Rn02_00367542 predicted 201
7 SASI_Rn02_00367543 predicted 267
8 SASI_Rn02_00367544 predicted 201
9 SASI_Rn02_00367545 predicted 301
10 SASI_Rn02_00367546 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312770 predicted 953
2 SASI_Mm01_00114744 predicted 1194
3 SASI_Mm01_00114745 predicted 2517
4 SASI_Mm02_00312771 predicted 2836
5 SASI_Mm01_00114748 predicted 1651
6 SASI_Mm01_00114750 predicted 2339
7 SASI_Mm01_00114751 predicted 1159
8 SASI_Mm01_00114752 predicted 861
9 SASI_Mm01_00114753 predicted 2314
10 SASI_Mm02_00312772 predicted 1864
11 SASI_Mm01_00114746 predicted 2539
12 SASI_Mm01_00114747 predicted 2000
13 SASI_Mm01_00114749 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001977
ENPEP MISSION shRNA Bacterial Glycerol Stock
glutamyl aminopeptidase (aminopeptidase A)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-2272s1c1
Sequence:CCGGGCTTTGAACTTGACCAAGTATCTCGAGATACTTGGTCAAGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-994s1c1
Sequence:CCGGCCCAAAGAATACGGAGCACTTCTCGAGAAGTGCTCCGTATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-1830s1c1
Sequence:CCGGGCTACCAGTGAAAGAAGTAATCTCGAGATTACTTCTTTCACTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-2760s1c1
Sequence:CCGGGCTCAAGGACACGAACCTTATCTCGAGATAAGGTTCGTGTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2625s21c1
Sequence:CCGGGAACAATGCTTCCTCGTTATTCTCGAGAATAACGAGGAAGCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-417s21c1
Sequence:CCGGGGTGGTGGGTGTAGGATTAATCTCGAGATTAATCCTACACCCACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2665s21c1
Sequence:CCGGACTGTAAGCCTTCCCGTAAATCTCGAGATTTACGGGAAGGCTTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-1705s21c1
Sequence:CCGGATGTCTTCGCATCCAATTATTCTCGAGAATAATTGGATGCGAAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2899s21c1
Sequence:CCGGGTCATTCGATATATCTCATATCTCGAGATATGAGATATATCGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001977
ENPEP MISSION shRNA shRNA Plasmid DNA
glutamyl aminopeptidase (aminopeptidase A)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-2272s1c1
Sequence:CCGGGCTTTGAACTTGACCAAGTATCTCGAGATACTTGGTCAAGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-994s1c1
Sequence:CCGGCCCAAAGAATACGGAGCACTTCTCGAGAAGTGCTCCGTATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-1830s1c1
Sequence:CCGGGCTACCAGTGAAAGAAGTAATCTCGAGATTACTTCTTTCACTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-2760s1c1
Sequence:CCGGGCTCAAGGACACGAACCTTATCTCGAGATAAGGTTCGTGTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2625s21c1
Sequence:CCGGGAACAATGCTTCCTCGTTATTCTCGAGAATAACGAGGAAGCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-417s21c1
Sequence:CCGGGGTGGTGGGTGTAGGATTAATCTCGAGATTAATCCTACACCCACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2665s21c1
Sequence:CCGGACTGTAAGCCTTCCCGTAAATCTCGAGATTTACGGGAAGGCTTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-1705s21c1
Sequence:CCGGATGTCTTCGCATCCAATTATTCTCGAGAATAATTGGATGCGAAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2899s21c1
Sequence:CCGGGTCATTCGATATATCTCATATCTCGAGATATGAGATATATCGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001977
ENPEP MISSION shRNA Lentiviral Transduction Particles
glutamyl aminopeptidase (aminopeptidase A)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-2272s1c1
Sequence:CCGGGCTTTGAACTTGACCAAGTATCTCGAGATACTTGGTCAAGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-994s1c1
Sequence:CCGGCCCAAAGAATACGGAGCACTTCTCGAGAAGTGCTCCGTATTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-1830s1c1
Sequence:CCGGGCTACCAGTGAAAGAAGTAATCTCGAGATTACTTCTTTCACTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001977.2-2760s1c1
Sequence:CCGGGCTCAAGGACACGAACCTTATCTCGAGATAAGGTTCGTGTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2625s21c1
Sequence:CCGGGAACAATGCTTCCTCGTTATTCTCGAGAATAACGAGGAAGCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-417s21c1
Sequence:CCGGGGTGGTGGGTGTAGGATTAATCTCGAGATTAATCCTACACCCACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2665s21c1
Sequence:CCGGACTGTAAGCCTTCCCGTAAATCTCGAGATTTACGGGAAGGCTTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-1705s21c1
Sequence:CCGGATGTCTTCGCATCCAATTATTCTCGAGAATAATTGGATGCGAAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001977.3-2899s21c1
Sequence:CCGGGTCATTCGATATATCTCATATCTCGAGATATGAGATATATCGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007934
VALIDATED
ENPEP MISSION shRNA Bacterial Glycerol Stock
glutamyl aminopeptidase (aminopeptidase A)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-3348s1c1
Sequence:CCGGGCAGGGTGTATTGCCATCTTACTCGAGTAAGATGGCAATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-1087s1c1
Sequence:CCGGGCGCTTCCTAAACTGGATAAACTCGAGTTTATCCAGTTTAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-1785s1c1
Sequence:CCGGGCTCGGTTACACATGGAATATCTCGAGATATTCCATGTGTAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-826s1c1
Sequence:CCGGGCACTTTCTAATATGCCAGAACTCGAGTTCTGGCATATTAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-2200s1c1
Sequence:CCGGCCCATGATAGAGACGTACTTTCTCGAGAAAGTACGTCTCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-3529s21c1
Sequence:CCGGGCAGGGTGTATTGCCATCTTACTCGAGTAAGATGGCAATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007934.3-1007s21c1
Sequence:CCGGGCACTTTCTAATATGCCAGAACTCGAGTTCTGGCATATTAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-2381s21c1
Sequence:CCGGCCCATGATAGAGACGTACTTTCTCGAGAAAGTACGTCTCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-1268s21c1
Sequence:CCGGGCGCTTCCTAAACTGGATAAACTCGAGTTTATCCAGTTTAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-714s21c1
Sequence:CCGGTTCGACGGTGCTTCGAGTATACTCGAGTATACTCGAAGCACCGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007934
VALIDATED
ENPEP MISSION shRNA shRNA Plasmid DNA
glutamyl aminopeptidase (aminopeptidase A)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-3348s1c1
Sequence:CCGGGCAGGGTGTATTGCCATCTTACTCGAGTAAGATGGCAATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-1087s1c1
Sequence:CCGGGCGCTTCCTAAACTGGATAAACTCGAGTTTATCCAGTTTAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-1785s1c1
Sequence:CCGGGCTCGGTTACACATGGAATATCTCGAGATATTCCATGTGTAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-826s1c1
Sequence:CCGGGCACTTTCTAATATGCCAGAACTCGAGTTCTGGCATATTAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-2200s1c1
Sequence:CCGGCCCATGATAGAGACGTACTTTCTCGAGAAAGTACGTCTCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-3529s21c1
Sequence:CCGGGCAGGGTGTATTGCCATCTTACTCGAGTAAGATGGCAATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007934.3-1007s21c1
Sequence:CCGGGCACTTTCTAATATGCCAGAACTCGAGTTCTGGCATATTAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-2381s21c1
Sequence:CCGGCCCATGATAGAGACGTACTTTCTCGAGAAAGTACGTCTCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-1268s21c1
Sequence:CCGGGCGCTTCCTAAACTGGATAAACTCGAGTTTATCCAGTTTAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-714s21c1
Sequence:CCGGTTCGACGGTGCTTCGAGTATACTCGAGTATACTCGAAGCACCGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007934
VALIDATED
ENPEP MISSION shRNA Lentiviral Transduction Particles
glutamyl aminopeptidase (aminopeptidase A)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-3348s1c1
Sequence:CCGGGCAGGGTGTATTGCCATCTTACTCGAGTAAGATGGCAATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-1087s1c1
Sequence:CCGGGCGCTTCCTAAACTGGATAAACTCGAGTTTATCCAGTTTAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-1785s1c1
Sequence:CCGGGCTCGGTTACACATGGAATATCTCGAGATATTCCATGTGTAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-826s1c1
Sequence:CCGGGCACTTTCTAATATGCCAGAACTCGAGTTCTGGCATATTAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007934.1-2200s1c1
Sequence:CCGGCCCATGATAGAGACGTACTTTCTCGAGAAAGTACGTCTCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-3529s21c1
Sequence:CCGGGCAGGGTGTATTGCCATCTTACTCGAGTAAGATGGCAATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007934.3-1007s21c1
Sequence:CCGGGCACTTTCTAATATGCCAGAACTCGAGTTCTGGCATATTAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-2381s21c1
Sequence:CCGGCCCATGATAGAGACGTACTTTCTCGAGAAAGTACGTCTCTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-1268s21c1
Sequence:CCGGGCGCTTCCTAAACTGGATAAACTCGAGTTTATCCAGTTTAGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007934.3-714s21c1
Sequence:CCGGTTCGACGGTGCTTCGAGTATACTCGAGTATACTCGAAGCACCGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks