EMAIL THIS PAGE TO A FRIEND

ENPP1

ectonucleotide pyrophosphatase/phosphodiesterase 1

85 Gene Product Result for
Synonyms: ARHR2 M6S1 NPP1 NPPS PC-1 PCA1 PDNP1
UniProtKB ID: P22413, Q5T9R6, Q9NPZ3, Q9P1P6, Q9UP61, Q9Y6K3
Gene ID:
Human(5167) Summary: This gene is a member of the ecto-nucleotide pyrophosphatase/phosphodiesterase (ENPP) family. The encoded protein is a type II transmembrane glycoprotein comprising two identical disulfide-bonded subunits. This protein has broad specificity and cleaves a variety of substrates, including phosphodiester bonds of nucleotides and nucleotide sugars and pyrophosphate bonds of nucleotides and nucleotide sugars. This protein may function to hydrolyze nucleoside 5' triphosphates to their corresponding monophosphates and may also hydrolyze diadenosine polyphosphates. Mutations in this gene have been associated with 'idiopathic' infantile arterial calcification, ossification of the posterior longitudinal ligament of the spine (OPLL), and insulin resistance. [provided by RefSeq, Jul 2008]
Mouse(18605) ectonucleotide pyrophosphatase/phosphodiesterase 1
Rat(85496) ectonucleotide pyrophosphatase/phosphodiesterase 1
domestic guinea pig(100726931) ectonucleotide pyrophosphatase/phosphodiesterase 1
naked mole-rat(101706464) ectonucleotide pyrophosphatase/phosphodiesterase 1
sheep(101123048) ectonucleotide pyrophosphatase/phosphodiesterase 1
Domestic Rabbit(100009517) ectonucleotide pyrophosphatase/phosphodiesterase 1
Zebrafish(562399) ectonucleotide pyrophosphatase/phosphodiesterase 1
cow(615535) ectonucleotide pyrophosphatase/phosphodiesterase 1
Horse(100073097) ectonucleotide pyrophosphatase/phosphodiesterase 1
domestic cat(101094350) ectonucleotide pyrophosphatase/phosphodiesterase 1
dog(476153) ectonucleotide pyrophosphatase/phosphodiesterase 1
chicken(426929) ectonucleotide pyrophosphatase/phosphodiesterase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006208 siRNAs that have been validated in the lab human pricing
NM_053535 Rosetta Predictions rat pricing
NM_008813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006208 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119610 validated 594
1 SASI_Hs01_00119609 validated 2168
2 SASI_Hs01_00119608 predicted 2382
3 SASI_Hs02_00341111 predicted 2047
4 SASI_Hs01_00119613 predicted 2319
5 SASI_Hs01_00119614 predicted 674
6 SASI_Hs01_00119615 predicted 1888
7 SASI_Hs01_00119616 predicted 399
8 SASI_Hs01_00119617 predicted 1972
9 SASI_Hs02_00341112 predicted 795
10 SASI_Hs02_00341113 predicted 545
11 SASI_Hs01_00119611 predicted 2497
12 SASI_Hs01_00119612 predicted 2438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111201 predicted 937
2 SASI_Rn01_00111202 predicted 1642
3 SASI_Rn01_00111204 predicted 764
4 SASI_Rn01_00111205 predicted 376
5 SASI_Rn01_00111206 predicted 462
6 SASI_Rn02_00266153 predicted 516
7 SASI_Rn01_00111207 predicted 1823
8 SASI_Rn01_00111208 predicted 1228
9 SASI_Rn01_00111209 predicted 218
10 SASI_Rn01_00111210 predicted 1089
11 SASI_Rn01_00111203 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054546 predicted 1534
2 SASI_Mm01_00054548 predicted 1441
3 SASI_Mm02_00314743 predicted 2125
4 SASI_Mm01_00054550 predicted 573
5 SASI_Mm01_00054551 predicted 1136
6 SASI_Mm01_00054552 predicted 1960
7 SASI_Mm02_00314744 predicted 2321
8 SASI_Mm01_00054553 predicted 327
9 SASI_Mm01_00054554 predicted 2466
10 SASI_Mm02_00314745 predicted 1048
11 SASI_Mm01_00054547 predicted 1055
12 SASI_Mm01_00054549 predicted 913
13 SASI_Mm01_00054555 predicted 2134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008813
VALIDATED
ENPP1 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-970s21c1
Sequence:CCGGCCGATTTGGGTGACCGCTAATCTCGAGATTAGCGGTCACCCAAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-2316s21c1
Sequence:CCGGAGCGCTGCTTACATCTAATATCTCGAGATATTAGATGTAAGCAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-1044s21c1
Sequence:CCGGTGACGGGATTCTACCAGATATCTCGAGATATCTGGTAGAATCCCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-3041s1c1
Sequence:CCGGGCAGACTTCCTGTCTAAGAATCTCGAGATTCTTAGACAGGAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-1444s1c1
Sequence:CCGGCCAGAGACATACTATTCATTTCTCGAGAAATGAATAGTATGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-754s1c1
Sequence:CCGGCCTGTCATTAGCAAGCTGAAACTCGAGTTTCAGCTTGCTAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008813.2-1849s1c1
Sequence:CCGGCCCATTTACAACCCAAGTCATCTCGAGATGACTTGGGTTGTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008813.2-2440s1c1
Sequence:CCGGCCCGTGTTTGACTTTGATTATCTCGAGATAATCAAAGTCAAACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008813
VALIDATED
ENPP1 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-970s21c1
Sequence:CCGGCCGATTTGGGTGACCGCTAATCTCGAGATTAGCGGTCACCCAAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-2316s21c1
Sequence:CCGGAGCGCTGCTTACATCTAATATCTCGAGATATTAGATGTAAGCAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-1044s21c1
Sequence:CCGGTGACGGGATTCTACCAGATATCTCGAGATATCTGGTAGAATCCCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-3041s1c1
Sequence:CCGGGCAGACTTCCTGTCTAAGAATCTCGAGATTCTTAGACAGGAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-1444s1c1
Sequence:CCGGCCAGAGACATACTATTCATTTCTCGAGAAATGAATAGTATGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-754s1c1
Sequence:CCGGCCTGTCATTAGCAAGCTGAAACTCGAGTTTCAGCTTGCTAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008813.2-1849s1c1
Sequence:CCGGCCCATTTACAACCCAAGTCATCTCGAGATGACTTGGGTTGTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008813.2-2440s1c1
Sequence:CCGGCCCGTGTTTGACTTTGATTATCTCGAGATAATCAAAGTCAAACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008813
VALIDATED
ENPP1 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-970s21c1
Sequence:CCGGCCGATTTGGGTGACCGCTAATCTCGAGATTAGCGGTCACCCAAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-2316s21c1
Sequence:CCGGAGCGCTGCTTACATCTAATATCTCGAGATATTAGATGTAAGCAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008813.3-1044s21c1
Sequence:CCGGTGACGGGATTCTACCAGATATCTCGAGATATCTGGTAGAATCCCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-3041s1c1
Sequence:CCGGGCAGACTTCCTGTCTAAGAATCTCGAGATTCTTAGACAGGAAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-1444s1c1
Sequence:CCGGCCAGAGACATACTATTCATTTCTCGAGAAATGAATAGTATGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008813.2-754s1c1
Sequence:CCGGCCTGTCATTAGCAAGCTGAAACTCGAGTTTCAGCTTGCTAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008813.2-1849s1c1
Sequence:CCGGCCCATTTACAACCCAAGTCATCTCGAGATGACTTGGGTTGTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008813.2-2440s1c1
Sequence:CCGGCCCGTGTTTGACTTTGATTATCTCGAGATAATCAAAGTCAAACACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006208
VALIDATED
ENPP1 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-432s1c1
Sequence:CCGGCGTGCATAGAACCAGAACATACTCGAGTATGTTCTGGTTCTATGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-2357s1c1
Sequence:CCGGCTGCGAAAGTATGCTGAAGAACTCGAGTTCTTCAGCATACTTTCGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-1893s1c1
Sequence:CCGGGCTCATGTAACCCTTCGATTTCTCGAGAAATCGAAGGGTTACATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-2643s1c1
Sequence:CCGGCATGGGTTGAAGAATTGTTAACTCGAGTTAACAATTCTTCAACCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006208.x-3435s1c1
Sequence:CCGGTGAGGGACGATCTTTGAATATCTCGAGATATTCAAAGATCGTCCCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006208
VALIDATED
ENPP1 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-432s1c1
Sequence:CCGGCGTGCATAGAACCAGAACATACTCGAGTATGTTCTGGTTCTATGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-2357s1c1
Sequence:CCGGCTGCGAAAGTATGCTGAAGAACTCGAGTTCTTCAGCATACTTTCGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-1893s1c1
Sequence:CCGGGCTCATGTAACCCTTCGATTTCTCGAGAAATCGAAGGGTTACATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-2643s1c1
Sequence:CCGGCATGGGTTGAAGAATTGTTAACTCGAGTTAACAATTCTTCAACCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006208.x-3435s1c1
Sequence:CCGGTGAGGGACGATCTTTGAATATCTCGAGATATTCAAAGATCGTCCCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006208
VALIDATED
ENPP1 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-432s1c1
Sequence:CCGGCGTGCATAGAACCAGAACATACTCGAGTATGTTCTGGTTCTATGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-2357s1c1
Sequence:CCGGCTGCGAAAGTATGCTGAAGAACTCGAGTTCTTCAGCATACTTTCGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-1893s1c1
Sequence:CCGGGCTCATGTAACCCTTCGATTTCTCGAGAAATCGAAGGGTTACATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006208.x-2643s1c1
Sequence:CCGGCATGGGTTGAAGAATTGTTAACTCGAGTTAACAATTCTTCAACCCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006208.x-3435s1c1
Sequence:CCGGTGAGGGACGATCTTTGAATATCTCGAGATATTCAAAGATCGTCCCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)