EMAIL THIS PAGE TO A FRIEND

ENPP2

ectonucleotide pyrophosphatase/phosphodiesterase 2

134 Gene Product Result for
Synonyms: ATX ATX-X AUTOTAXIN LysoPLD NPP2 PD-IALPHA PDNP2
Gene ID:
Human(5168) Summary: The protein encoded by this gene functions as both a phosphodiesterase, which cleaves phosphodiester bonds at the 5' end of oligonucleotides, and a phospholipase, which catalyzes production of lysophosphatidic acid (LPA) in extracellular fluids. LPA evokes growth factor-like responses including stimulation of cell proliferation and chemotaxis. This gene product stimulates the motility of tumor cells and has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The gene product is secreted and further processed to make the biologically active form. Several alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2008]
Mouse(18606) ectonucleotide pyrophosphatase/phosphodiesterase 2
Rat(84050) ectonucleotide pyrophosphatase/phosphodiesterase 2
Zebrafish(393575) ectonucleotide pyrophosphatase/phosphodiesterase 2
chicken(420361) ectonucleotide pyrophosphatase/phosphodiesterase 2
dog(482026) ectonucleotide pyrophosphatase/phosphodiesterase 2
Horse(100057101) ectonucleotide pyrophosphatase/phosphodiesterase 2
cow(532663) ectonucleotide pyrophosphatase/phosphodiesterase 2
domestic cat(101097620) ectonucleotide pyrophosphatase/phosphodiesterase 2
sheep(101120171) ectonucleotide pyrophosphatase/phosphodiesterase 2
naked mole-rat(101710936) ectonucleotide pyrophosphatase/phosphodiesterase 2
domestic guinea pig(100722506) ectonucleotide pyrophosphatase/phosphodiesterase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006209 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040092 Rosetta Predictions human pricing
NM_006209 Rosetta Predictions human pricing
NM_057104 Rosetta Predictions rat pricing
XM_579590 Rosetta Predictions rat pricing
NM_015744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128559 predicted 1446
2 SASI_Hs01_00128560 predicted 1930
3 SASI_Hs01_00128562 predicted 1906
4 SASI_Hs02_00308813 predicted 626
5 SASI_Hs01_00128563 predicted 1732
6 SASI_Hs01_00128564 predicted 309
7 SASI_Hs01_00128565 predicted 2694
8 SASI_Hs01_00128566 predicted 1722
9 SASI_Hs01_00128567 predicted 2655
10 SASI_Hs02_00308814 predicted 2243
11 SASI_Hs01_00128558 predicted 1558
12 SASI_Hs01_00128561 predicted 2630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195454 predicted 1607
2 SASI_Hs01_00195455 predicted 2087
3 SASI_Hs02_00341114 predicted 393
4 SASI_Hs01_00195457 predicted 2067
5 SASI_Hs02_00341115 predicted 630
6 SASI_Hs01_00195458 predicted 1889
7 SASI_Hs01_00195459 predicted 311
8 SASI_Hs01_00195460 predicted 2849
9 SASI_Hs01_00195461 predicted 1878
10 SASI_Hs01_00195462 predicted 2807
11 SASI_Hs01_00195453 predicted 1706
12 SASI_Hs01_00195456 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053710 predicted 1205
2 SASI_Rn01_00053711 predicted 1907
3 SASI_Rn02_00267036 predicted 1727
4 SASI_Rn01_00053712 predicted 1258
5 SASI_Rn01_00053713 predicted 1094
6 SASI_Rn01_00053714 predicted 1213
7 SASI_Rn01_00053715 predicted 2284
8 SASI_Rn01_00053716 predicted 1817
9 SASI_Rn01_00053718 predicted 1390
10 SASI_Rn01_00053719 predicted 560
11 SASI_Rn01_00053717 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132620 predicted 759
2 SASI_Rn01_00132621 predicted 519
3 SASI_Rn01_00132622 predicted 347
4 SASI_Rn01_00132623 predicted 628
5 SASI_Rn01_00132624 predicted 556
6 SASI_Rn01_00132625 predicted 1061
7 SASI_Rn01_00132626 predicted 777
8 SASI_Rn01_00132627 predicted 760
9 SASI_Rn01_00132628 predicted 867
10 SASI_Rn01_00132629 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066744 predicted 1067
2 SASI_Mm01_00066745 predicted 2006
3 SASI_Mm01_00066746 predicted 2314
4 SASI_Mm01_00066748 predicted 1316
5 SASI_Mm01_00066749 predicted 1296
6 SASI_Mm01_00066750 predicted 1309
7 SASI_Mm02_00323074 predicted 258
8 SASI_Mm02_00323075 predicted 1828
9 SASI_Mm01_00066751 predicted 1905
10 SASI_Mm01_00066752 predicted 1986
11 SASI_Mm01_00066747 predicted 1347
12 SASI_Mm01_00066753 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015744
ENPP2 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015744.1-2908s1c1
Sequence:CCGGGCCAGTTGGATATTGTGCATTCTCGAGAATGCACAATATCCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1463s1c1
Sequence:CCGGCGGCTTTGATAACAAGGTCAACTCGAGTTGACCTTGTTATCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-938s1c1
Sequence:CCGGGCCTTCAGTTTATGCCTTCTACTCGAGTAGAAGGCATAAACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1218s1c1
Sequence:CCGGCGACCCAAGATTCCCAATAATCTCGAGATTATTGGGAATCTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1738s1c1
Sequence:CCGGGCACCTGTGATGATAAGGTAACTCGAGTTACCTTATCATCACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015744
ENPP2 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015744.1-2908s1c1
Sequence:CCGGGCCAGTTGGATATTGTGCATTCTCGAGAATGCACAATATCCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1463s1c1
Sequence:CCGGCGGCTTTGATAACAAGGTCAACTCGAGTTGACCTTGTTATCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-938s1c1
Sequence:CCGGGCCTTCAGTTTATGCCTTCTACTCGAGTAGAAGGCATAAACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1218s1c1
Sequence:CCGGCGACCCAAGATTCCCAATAATCTCGAGATTATTGGGAATCTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1738s1c1
Sequence:CCGGGCACCTGTGATGATAAGGTAACTCGAGTTACCTTATCATCACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015744
ENPP2 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015744.1-2908s1c1
Sequence:CCGGGCCAGTTGGATATTGTGCATTCTCGAGAATGCACAATATCCAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1463s1c1
Sequence:CCGGCGGCTTTGATAACAAGGTCAACTCGAGTTGACCTTGTTATCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-938s1c1
Sequence:CCGGGCCTTCAGTTTATGCCTTCTACTCGAGTAGAAGGCATAAACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1218s1c1
Sequence:CCGGCGACCCAAGATTCCCAATAATCTCGAGATTATTGGGAATCTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015744.1-1738s1c1
Sequence:CCGGGCACCTGTGATGATAAGGTAACTCGAGTTACCTTATCATCACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006209
ENPP2 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-572s1c2
Sequence:CCGGCGTGCATCATACATGAAGAAACTCGAGTTTCTTCATGTATGATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006209.2-2905s1c1
Sequence:CCGGCCTGTACCAAATCTGACATATCTCGAGATATGTCAGATTTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-1769s1c1
Sequence:CCGGGCTCCTAATAATGGGACCCATCTCGAGATGGGTCCCATTATTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-2414s1c1
Sequence:CCGGCCAATCTTCGACTATGACTATCTCGAGATAGTCATAGTCGAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-2057s21c1
Sequence:CCGGTTATCGGACTAGATATGATATCTCGAGATATCATATCTAGTCCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-167s21c1
Sequence:CCGGATTCACTGCACATCGAATTAACTCGAGTTAATTCGATGTGCAGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-1881s21c1
Sequence:CCGGGAAGTTACCAGACCCAATTATCTCGAGATAATTGGGTCTGGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-1707s21c1
Sequence:CCGGGTAGGTTATGGCTCAACATTTCTCGAGAAATGTTGAGCCATAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006209
ENPP2 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-572s1c2
Sequence:CCGGCGTGCATCATACATGAAGAAACTCGAGTTTCTTCATGTATGATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006209.2-2905s1c1
Sequence:CCGGCCTGTACCAAATCTGACATATCTCGAGATATGTCAGATTTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-1769s1c1
Sequence:CCGGGCTCCTAATAATGGGACCCATCTCGAGATGGGTCCCATTATTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-2414s1c1
Sequence:CCGGCCAATCTTCGACTATGACTATCTCGAGATAGTCATAGTCGAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-2057s21c1
Sequence:CCGGTTATCGGACTAGATATGATATCTCGAGATATCATATCTAGTCCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-167s21c1
Sequence:CCGGATTCACTGCACATCGAATTAACTCGAGTTAATTCGATGTGCAGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-1881s21c1
Sequence:CCGGGAAGTTACCAGACCCAATTATCTCGAGATAATTGGGTCTGGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-1707s21c1
Sequence:CCGGGTAGGTTATGGCTCAACATTTCTCGAGAAATGTTGAGCCATAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006209
ENPP2 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-572s1c2
Sequence:CCGGCGTGCATCATACATGAAGAAACTCGAGTTTCTTCATGTATGATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006209.2-2905s1c1
Sequence:CCGGCCTGTACCAAATCTGACATATCTCGAGATATGTCAGATTTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-1769s1c1
Sequence:CCGGGCTCCTAATAATGGGACCCATCTCGAGATGGGTCCCATTATTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006209.2-2414s1c1
Sequence:CCGGCCAATCTTCGACTATGACTATCTCGAGATAGTCATAGTCGAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-2057s21c1
Sequence:CCGGTTATCGGACTAGATATGATATCTCGAGATATCATATCTAGTCCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-167s21c1
Sequence:CCGGATTCACTGCACATCGAATTAACTCGAGTTAATTCGATGTGCAGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-1881s21c1
Sequence:CCGGGAAGTTACCAGACCCAATTATCTCGAGATAATTGGGTCTGGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006209.3-1707s21c1
Sequence:CCGGGTAGGTTATGGCTCAACATTTCTCGAGAAATGTTGAGCCATAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks