EMAIL THIS PAGE TO A FRIEND

ENPP3

ectonucleotide pyrophosphatase/phosphodiesterase 3

119 Gene Product Result for
Synonyms: B10 CD203c NPP3 PD-IBETA PDNP3
UniProtKB ID: O14638, Q5JTL3
Gene ID:
Human(5169) Summary: The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. [provided by RefSeq, Jul 2008]
Mouse(209558) ectonucleotide pyrophosphatase/phosphodiesterase 3
Rat(54410) ectonucleotide pyrophosphatase/phosphodiesterase 3
domestic guinea pig(100727209) ectonucleotide pyrophosphatase/phosphodiesterase 3
naked mole-rat(101705137) ectonucleotide pyrophosphatase/phosphodiesterase 3
sheep(101122795) ectonucleotide pyrophosphatase/phosphodiesterase 3
chicken(426928) ectonucleotide pyrophosphatase/phosphodiesterase 3
cow(529405) ectonucleotide pyrophosphatase/phosphodiesterase 3
Horse(100067583) ectonucleotide pyrophosphatase/phosphodiesterase 3
domestic cat(101094103) ectonucleotide pyrophosphatase/phosphodiesterase 3
dog(474820) ectonucleotide pyrophosphatase/phosphodiesterase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005021 Rosetta Predictions human pricing
NM_019370 Rosetta Predictions rat pricing
XM_579437 Rosetta Predictions rat pricing
NM_134005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206186 predicted 1389
2 SASI_Hs01_00206187 predicted 1222
3 SASI_Hs01_00206188 predicted 1104
4 SASI_Hs01_00206184 predicted 445
5 SASI_Hs01_00206190 predicted 1671
6 SASI_Hs02_00338794 predicted 1835
7 SASI_Hs01_00206191 predicted 540
8 SASI_Hs01_00206192 predicted 2406
9 SASI_Hs01_00206193 predicted 392
10 SASI_Hs02_00338795 predicted 245
11 SASI_Hs01_00206185 predicted 1419
12 SASI_Hs01_00206189 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262391 predicted 2147
2 SASI_Rn01_00110245 predicted 1265
3 SASI_Rn02_00262392 predicted 518
4 SASI_Rn01_00110247 predicted 2514
5 SASI_Rn01_00110248 predicted 2238
6 SASI_Rn01_00110249 predicted 2157
7 SASI_Rn01_00110250 predicted 2385
8 SASI_Rn01_00110251 predicted 2333
9 SASI_Rn02_00262393 predicted 1068
10 SASI_Rn01_00110252 predicted 924
11 SASI_Rn01_00110244 predicted 560
12 SASI_Rn01_00110246 predicted 2137
13 SASI_Rn01_00110253 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192424 predicted 2490
2 SASI_Rn01_00192425 predicted 2525
3 SASI_Rn01_00192426 predicted 2352
4 SASI_Rn01_00192427 predicted 869
5 SASI_Rn01_00192428 predicted 2383
6 SASI_Rn01_00192429 predicted 209
7 SASI_Rn01_00192430 predicted 2399
8 SASI_Rn01_00192431 predicted 2371
9 SASI_Rn01_00192432 predicted 2482
10 SASI_Rn01_00192433 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339145 predicted 2227
2 SASI_Mm01_00057027 predicted 968
3 SASI_Mm01_00057028 predicted 1192
4 SASI_Mm01_00057029 predicted 2193
5 SASI_Mm01_00057030 predicted 1310
6 SASI_Mm02_00339146 predicted 972
7 SASI_Mm01_00057031 predicted 990
8 SASI_Mm01_00057034 predicted 948
9 SASI_Mm01_00057036 predicted 1084
10 SASI_Mm02_00339147 predicted 1832
11 SASI_Mm01_00057032 predicted 1813
12 SASI_Mm01_00057033 predicted 1321
13 SASI_Mm01_00057035 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005021
VALIDATED
ENPP3 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1552s21c1
Sequence:CCGGGGAGCATGGAGGCTATCTTTCCTCGAGGAAAGATAGCCTCCATGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-549s21c1
Sequence:CCGGTTTGACCTGCCACCAGTTATCCTCGAGGATAACTGGTGGCAGGTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1145s21c1
Sequence:CCGGAGGCCTGAAGCAGCGGAATTTCTCGAGAAATTCCGCTGCTTCAGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1520s21c1
Sequence:CCGGAGGAGGCAACCATGGTTATAACTCGAGTTATAACCATGGTTGCCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1438s21c1
Sequence:CCGGAGAACGTCAGAATCGACAAAGCTCGAGCTTTGTCGATTCTGACGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005021.3-2998s21c1
Sequence:CCGGTTATCTTACTCAGAATCTTTGCTCGAGCAAAGATTCTGAGTAAGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005021.3-2906s21c1
Sequence:CCGGACACAGAGATGATGCTATATTCTCGAGAATATAGCATCATCTCTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-2316s21c1
Sequence:CCGGGTGGTTAGTGGACCAATATTTCTCGAGAAATATTGGTCCACTAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_005021.2-269s1c1
Sequence:CCGGGCATGTAAAGACCGAGGTGATCTCGAGATCACCTCGGTCTTTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005021.2-1177s1c1
Sequence:CCGGCCAGACTTATTGTAACAAGATCTCGAGATCTTGTTACAATAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-83s1c1
Sequence:CCGGCCTGTTAAGAAGAACACTCTTCTCGAGAAGAGTGTTCTTCTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-1637s1c1
Sequence:CCGGGCACCAAACAATGGAACCCATCTCGAGATGGGTTCCATTGTTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-864s1c2
Sequence:CCGGCCGGATCAGAAGTGGCTATAACTCGAGTTATAGCCACTTCTGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005021
VALIDATED
ENPP3 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1552s21c1
Sequence:CCGGGGAGCATGGAGGCTATCTTTCCTCGAGGAAAGATAGCCTCCATGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-549s21c1
Sequence:CCGGTTTGACCTGCCACCAGTTATCCTCGAGGATAACTGGTGGCAGGTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1145s21c1
Sequence:CCGGAGGCCTGAAGCAGCGGAATTTCTCGAGAAATTCCGCTGCTTCAGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1520s21c1
Sequence:CCGGAGGAGGCAACCATGGTTATAACTCGAGTTATAACCATGGTTGCCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1438s21c1
Sequence:CCGGAGAACGTCAGAATCGACAAAGCTCGAGCTTTGTCGATTCTGACGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005021.3-2998s21c1
Sequence:CCGGTTATCTTACTCAGAATCTTTGCTCGAGCAAAGATTCTGAGTAAGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005021.3-2906s21c1
Sequence:CCGGACACAGAGATGATGCTATATTCTCGAGAATATAGCATCATCTCTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-2316s21c1
Sequence:CCGGGTGGTTAGTGGACCAATATTTCTCGAGAAATATTGGTCCACTAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_005021.2-269s1c1
Sequence:CCGGGCATGTAAAGACCGAGGTGATCTCGAGATCACCTCGGTCTTTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005021.2-1177s1c1
Sequence:CCGGCCAGACTTATTGTAACAAGATCTCGAGATCTTGTTACAATAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-83s1c1
Sequence:CCGGCCTGTTAAGAAGAACACTCTTCTCGAGAAGAGTGTTCTTCTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-1637s1c1
Sequence:CCGGGCACCAAACAATGGAACCCATCTCGAGATGGGTTCCATTGTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-864s1c2
Sequence:CCGGCCGGATCAGAAGTGGCTATAACTCGAGTTATAGCCACTTCTGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005021
VALIDATED
ENPP3 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1552s21c1
Sequence:CCGGGGAGCATGGAGGCTATCTTTCCTCGAGGAAAGATAGCCTCCATGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-549s21c1
Sequence:CCGGTTTGACCTGCCACCAGTTATCCTCGAGGATAACTGGTGGCAGGTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1145s21c1
Sequence:CCGGAGGCCTGAAGCAGCGGAATTTCTCGAGAAATTCCGCTGCTTCAGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1520s21c1
Sequence:CCGGAGGAGGCAACCATGGTTATAACTCGAGTTATAACCATGGTTGCCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-1438s21c1
Sequence:CCGGAGAACGTCAGAATCGACAAAGCTCGAGCTTTGTCGATTCTGACGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005021.3-2998s21c1
Sequence:CCGGTTATCTTACTCAGAATCTTTGCTCGAGCAAAGATTCTGAGTAAGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005021.3-2906s21c1
Sequence:CCGGACACAGAGATGATGCTATATTCTCGAGAATATAGCATCATCTCTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005021.3-2316s21c1
Sequence:CCGGGTGGTTAGTGGACCAATATTTCTCGAGAAATATTGGTCCACTAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_005021.2-269s1c1
Sequence:CCGGGCATGTAAAGACCGAGGTGATCTCGAGATCACCTCGGTCTTTACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005021.2-1177s1c1
Sequence:CCGGCCAGACTTATTGTAACAAGATCTCGAGATCTTGTTACAATAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-83s1c1
Sequence:CCGGCCTGTTAAGAAGAACACTCTTCTCGAGAAGAGTGTTCTTCTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-1637s1c1
Sequence:CCGGGCACCAAACAATGGAACCCATCTCGAGATGGGTTCCATTGTTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005021.2-864s1c2
Sequence:CCGGCCGGATCAGAAGTGGCTATAACTCGAGTTATAGCCACTTCTGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125594
ENPP3 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125594.4-1577s1c1
Sequence:CCGGCGGAACCTATTGTAAATTCAACTCGAGTTGAATTTACAATAGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-317s1c1
Sequence:CCGGCCTGTGTGAAATCAACTCAAACTCGAGTTTGAGTTGATTTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-1286s1c1
Sequence:CCGGCTCAGGACTTCTTTACATTTACTCGAGTAAATGTAAAGAAGTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-531s1c1
Sequence:CCGGACCAGTTATCTTGTTCTCCATCTCGAGATGGAGAACAAGATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-827s1c1
Sequence:CCGGCGGCAATGTATCAAGGTTTAACTCGAGTTAAACCTTGATACATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125594
ENPP3 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125594.4-1577s1c1
Sequence:CCGGCGGAACCTATTGTAAATTCAACTCGAGTTGAATTTACAATAGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-317s1c1
Sequence:CCGGCCTGTGTGAAATCAACTCAAACTCGAGTTTGAGTTGATTTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-1286s1c1
Sequence:CCGGCTCAGGACTTCTTTACATTTACTCGAGTAAATGTAAAGAAGTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-531s1c1
Sequence:CCGGACCAGTTATCTTGTTCTCCATCTCGAGATGGAGAACAAGATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-827s1c1
Sequence:CCGGCGGCAATGTATCAAGGTTTAACTCGAGTTAAACCTTGATACATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125594
ENPP3 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125594.4-1577s1c1
Sequence:CCGGCGGAACCTATTGTAAATTCAACTCGAGTTGAATTTACAATAGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-317s1c1
Sequence:CCGGCCTGTGTGAAATCAACTCAAACTCGAGTTTGAGTTGATTTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-1286s1c1
Sequence:CCGGCTCAGGACTTCTTTACATTTACTCGAGTAAATGTAAAGAAGTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-531s1c1
Sequence:CCGGACCAGTTATCTTGTTCTCCATCTCGAGATGGAGAACAAGATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125594.4-827s1c1
Sequence:CCGGCGGCAATGTATCAAGGTTTAACTCGAGTTAAACCTTGATACATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)