EMAIL THIS PAGE TO A FRIEND

ENPP4

ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)

57 Gene Product Result for
Synonyms: NPP4
UniProtKB ID: Q9Y6X5, A8K5G1, Q7L2N1
Gene ID:
Mouse(224794) ectonucleotide pyrophosphatase/phosphodiesterase 4
Rat(301261) ectonucleotide pyrophosphatase/phosphodiesterase 4
Zebrafish(550586) ectonucleotide pyrophosphatase/phosphodiesterase 4
domestic cat(101089863) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Horse(100068264) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
cow(538583) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
dog(481823) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
chicken(422055) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
sheep(101119767) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Domestic Rabbit(100339399) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
naked mole-rat(101721340) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
domestic guinea pig(100728826) ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014936 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012681 MISSION® esiRNA esiRNA targeting human ENPP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014936 Rosetta Predictions human pricing
NM_001106892 Rosetta Predictions rat pricing
NM_199016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238986 predicted 966
2 SASI_Hs02_00346600 predicted 753
3 SASI_Hs01_00238987 predicted 1307
4 SASI_Hs02_00346601 predicted 993
5 SASI_Hs01_00238988 predicted 392
6 SASI_Hs01_00238989 predicted 317
7 SASI_Hs01_00238990 predicted 1117
8 SASI_Hs01_00238991 predicted 299
9 SASI_Hs01_00238992 predicted 555
10 SASI_Hs01_00238994 predicted 687
11 SASI_Hs01_00238993 predicted 382
12 SASI_Hs01_00238995 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223436 predicted 1341
2 SASI_Rn02_00223437 predicted 569
3 SASI_Rn02_00223438 predicted 959
4 SASI_Rn02_00223439 predicted 1093
5 SASI_Rn02_00223440 predicted 631
6 SASI_Rn02_00223441 predicted 226
7 SASI_Rn02_00223442 predicted 858
8 SASI_Rn02_00223443 predicted 1482
9 SASI_Rn02_00223444 predicted 1308
10 SASI_Rn02_00223445 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147150 predicted 414
2 SASI_Mm01_00147151 predicted 1045
3 SASI_Mm01_00147152 predicted 856
4 SASI_Mm01_00147153 predicted 1419
5 SASI_Mm01_00147154 predicted 1279
6 SASI_Mm01_00147155 predicted 1111
7 SASI_Mm01_00147156 predicted 957
8 SASI_Mm01_00147157 predicted 805
9 SASI_Mm01_00147158 predicted 750
10 SASI_Mm01_00147159 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199016
ENPP4 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199016.1-1552s1c1
Sequence:CCGGGAGTGGTGTTACAGCCATAAACTCGAGTTTATGGCTGTAACACCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-912s1c1
Sequence:CCGGGACCGTTCAAACTACAGTGTTCTCGAGAACACTGTAGTTTGAACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-759s1c1
Sequence:CCGGCGGGTATTGAAAGAAGTAGATCTCGAGATCTACTTCTTTCAATACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-1156s1c1
Sequence:CCGGGCTATGATAATTCCCTGCCTACTCGAGTAGGCAGGGAATTATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-225s1c1
Sequence:CCGGCGGTTACTTCTGGTATCCTTTCTCGAGAAAGGATACCAGAAGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199016
ENPP4 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199016.1-1552s1c1
Sequence:CCGGGAGTGGTGTTACAGCCATAAACTCGAGTTTATGGCTGTAACACCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-912s1c1
Sequence:CCGGGACCGTTCAAACTACAGTGTTCTCGAGAACACTGTAGTTTGAACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-759s1c1
Sequence:CCGGCGGGTATTGAAAGAAGTAGATCTCGAGATCTACTTCTTTCAATACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-1156s1c1
Sequence:CCGGGCTATGATAATTCCCTGCCTACTCGAGTAGGCAGGGAATTATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-225s1c1
Sequence:CCGGCGGTTACTTCTGGTATCCTTTCTCGAGAAAGGATACCAGAAGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199016
ENPP4 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199016.1-1552s1c1
Sequence:CCGGGAGTGGTGTTACAGCCATAAACTCGAGTTTATGGCTGTAACACCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-912s1c1
Sequence:CCGGGACCGTTCAAACTACAGTGTTCTCGAGAACACTGTAGTTTGAACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-759s1c1
Sequence:CCGGCGGGTATTGAAAGAAGTAGATCTCGAGATCTACTTCTTTCAATACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-1156s1c1
Sequence:CCGGGCTATGATAATTCCCTGCCTACTCGAGTAGGCAGGGAATTATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199016.1-225s1c1
Sequence:CCGGCGGTTACTTCTGGTATCCTTTCTCGAGAAAGGATACCAGAAGTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376503
VALIDATED
ENPP4 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1486s1c1
Sequence:CCGGCCATGCTAACATGCCTCATAACTCGAGTTATGAGGCATGTTAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376503.1-303s1c1
Sequence:CCGGCCACCTAAGTTACTACTAGTACTCGAGTACTAGTAGTAACTTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1377s1c1
Sequence:CCGGCATCCCAATAATGGGACCTTTCTCGAGAAAGGTCCCATTATTGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376503.1-662s1c1
Sequence:CCGGCGATACCATCTCTTCCTATTTCTCGAGAAATAGGAAGAGATGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1318s1c1
Sequence:CCGGGCACAATTAACATTGTGGATACTCGAGTATCCACAATGTTAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376503
VALIDATED
ENPP4 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1486s1c1
Sequence:CCGGCCATGCTAACATGCCTCATAACTCGAGTTATGAGGCATGTTAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376503.1-303s1c1
Sequence:CCGGCCACCTAAGTTACTACTAGTACTCGAGTACTAGTAGTAACTTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1377s1c1
Sequence:CCGGCATCCCAATAATGGGACCTTTCTCGAGAAAGGTCCCATTATTGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376503.1-662s1c1
Sequence:CCGGCGATACCATCTCTTCCTATTTCTCGAGAAATAGGAAGAGATGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1318s1c1
Sequence:CCGGGCACAATTAACATTGTGGATACTCGAGTATCCACAATGTTAATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376503
VALIDATED
ENPP4 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1486s1c1
Sequence:CCGGCCATGCTAACATGCCTCATAACTCGAGTTATGAGGCATGTTAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376503.1-303s1c1
Sequence:CCGGCCACCTAAGTTACTACTAGTACTCGAGTACTAGTAGTAACTTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1377s1c1
Sequence:CCGGCATCCCAATAATGGGACCTTTCTCGAGAAAGGTCCCATTATTGGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376503.1-662s1c1
Sequence:CCGGCGATACCATCTCTTCCTATTTCTCGAGAAATAGGAAGAGATGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376503.1-1318s1c1
Sequence:CCGGGCACAATTAACATTGTGGATACTCGAGTATCCACAATGTTAATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014936
ENPP4 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1211s21c1
Sequence:CCGGGCCGATGAAGGCTGGACAATTCTCGAGAATTGTCCAGCCTTCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1284s21c1
Sequence:CCGGTGCCTAGTATGCATCCATTTCCTCGAGGAAATGGATGCATACTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014936.4-1798s21c1
Sequence:CCGGGATAACGCTGACCATAGTAAACTCGAGTTTACTATGGTCAGCGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-735s21c1
Sequence:CCGGCATTTGAGGAAAGACTAAATACTCGAGTATTTAGTCTTTCCTCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-514s21c1
Sequence:CCGGCCATGGCATTGTGGCTAATTCCTCGAGGAATTAGCCACAATGCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014936.4-1728s21c1
Sequence:CCGGACTTAGACTAAGCATGTTAAACTCGAGTTTAACATGCTTAGTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1517s21c1
Sequence:CCGGATGCTAACATGCCTCATAATACTCGAGTATTATGAGGCATGTTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-598s21c1
Sequence:CCGGGAATGAGGCAGTACCTATTTGCTCGAGCAAATAGGTACTGCCTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014936
ENPP4 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1211s21c1
Sequence:CCGGGCCGATGAAGGCTGGACAATTCTCGAGAATTGTCCAGCCTTCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1284s21c1
Sequence:CCGGTGCCTAGTATGCATCCATTTCCTCGAGGAAATGGATGCATACTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014936.4-1798s21c1
Sequence:CCGGGATAACGCTGACCATAGTAAACTCGAGTTTACTATGGTCAGCGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-735s21c1
Sequence:CCGGCATTTGAGGAAAGACTAAATACTCGAGTATTTAGTCTTTCCTCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-514s21c1
Sequence:CCGGCCATGGCATTGTGGCTAATTCCTCGAGGAATTAGCCACAATGCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014936.4-1728s21c1
Sequence:CCGGACTTAGACTAAGCATGTTAAACTCGAGTTTAACATGCTTAGTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1517s21c1
Sequence:CCGGATGCTAACATGCCTCATAATACTCGAGTATTATGAGGCATGTTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-598s21c1
Sequence:CCGGGAATGAGGCAGTACCTATTTGCTCGAGCAAATAGGTACTGCCTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014936
ENPP4 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1211s21c1
Sequence:CCGGGCCGATGAAGGCTGGACAATTCTCGAGAATTGTCCAGCCTTCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1284s21c1
Sequence:CCGGTGCCTAGTATGCATCCATTTCCTCGAGGAAATGGATGCATACTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014936.4-1798s21c1
Sequence:CCGGGATAACGCTGACCATAGTAAACTCGAGTTTACTATGGTCAGCGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-735s21c1
Sequence:CCGGCATTTGAGGAAAGACTAAATACTCGAGTATTTAGTCTTTCCTCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-514s21c1
Sequence:CCGGCCATGGCATTGTGGCTAATTCCTCGAGGAATTAGCCACAATGCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014936.4-1728s21c1
Sequence:CCGGACTTAGACTAAGCATGTTAAACTCGAGTTTAACATGCTTAGTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-1517s21c1
Sequence:CCGGATGCTAACATGCCTCATAATACTCGAGTATTATGAGGCATGTTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014936.4-598s21c1
Sequence:CCGGGAATGAGGCAGTACCTATTTGCTCGAGCAAATAGGTACTGCCTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)