EMAIL THIS PAGE TO A FRIEND

ENPP5

ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)

54 Gene Product Result for
UniProtKB ID: Q9UJA9, Q5TFV2, Q6UX49
Gene ID:
Mouse(83965) ectonucleotide pyrophosphatase/phosphodiesterase 5
Rat(316249) ectonucleotide pyrophosphatase/phosphodiesterase 5
domestic guinea pig(100728547) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
naked mole-rat(101720973) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
sheep(101120026) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Domestic Rabbit(100342891) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Zebrafish(563498) ectonucleotide pyrophosphatase/phosphodiesterase 5
cow(512304) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Horse(100055708) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
domestic cat(101099462) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
dog(481824) ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032003 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032003 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032003 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021572 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021572 Rosetta Predictions human pricing
NM_001012744 Rosetta Predictions rat pricing
NM_032003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128827 predicted 845
2 SASI_Hs01_00128828 predicted 1070
3 SASI_Hs01_00128830 predicted 1424
4 SASI_Hs01_00128831 predicted 981
5 SASI_Hs01_00128832 predicted 1315
6 SASI_Hs01_00128833 predicted 584
7 SASI_Hs02_00354933 predicted 1193
8 SASI_Hs01_00128834 predicted 875
9 SASI_Hs01_00128835 predicted 1028
10 SASI_Hs02_00354934 predicted 1396
11 SASI_Hs01_00128826 predicted 1193
12 SASI_Hs01_00128829 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096242 predicted 835
2 SASI_Rn01_00096243 predicted 1469
3 SASI_Rn01_00096245 predicted 540
4 SASI_Rn01_00096246 predicted 962
5 SASI_Rn01_00096247 predicted 271
6 SASI_Rn01_00096248 predicted 1102
7 SASI_Rn01_00096249 predicted 919
8 SASI_Rn01_00096250 predicted 1098
9 SASI_Rn02_00200603 predicted 1115
10 SASI_Rn01_00096251 predicted 1272
11 SASI_Rn01_00096244 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177308 predicted 1100
2 SASI_Mm01_00177309 predicted 1014
3 SASI_Mm02_00337216 predicted 226
4 SASI_Mm01_00177310 predicted 1622
5 SASI_Mm01_00177311 predicted 507
6 SASI_Mm02_00337217 predicted 594
7 SASI_Mm01_00177312 predicted 324
8 SASI_Mm01_00177313 predicted 1660
9 SASI_Mm01_00177315 predicted 1600
10 SASI_Mm01_00177316 predicted 816
11 SASI_Mm01_00177314 predicted 982
12 SASI_Mm01_00177317 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032003
VALIDATED
ENPP5 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-366s21c1
Sequence:CCGGTACCCTAACCATTACACTTTGCTCGAGCAAAGTGTAATGGTTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-259s21c1
Sequence:CCGGGATTCCGCTGGGATTACTTATCTCGAGATAAGTAATCCCAGCGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-599s21c1
Sequence:CCGGCCCGACCTATTATCTACCTTACTCGAGTAAGGTAGATAATAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-1941s21c1
Sequence:CCGGGCATCTAGTAACTTGATTGAACTCGAGTTCAATCAAGTTACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-1020s21c1
Sequence:CCGGCCTAATCTAACGGTCTATAAACTCGAGTTTATAGACCGTTAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-1430s21c1
Sequence:CCGGAGAGGAATCGTACCCTTATTACTCGAGTAATAAGGGTACGATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-1941s1c1
Sequence:CCGGGCATCTAGTAACTTGATTGAACTCGAGTTCAATCAAGTTACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_032003.1-1304s1c1
Sequence:CCGGCCTGCCACACAATGGATCATTCTCGAGAATGATCCATTGTGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-508s1c1
Sequence:CCGGCCACACCAATATGGATCACAACTCGAGTTGTGATCCATATTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-1518s1c1
Sequence:CCGGCGCAGTCAAGTGCATACTTTACTCGAGTAAAGTATGCACTTGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-599s1c1
Sequence:CCGGCCCGACCTATTATCTACCTTACTCGAGTAAGGTAGATAATAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032003
VALIDATED
ENPP5 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-366s21c1
Sequence:CCGGTACCCTAACCATTACACTTTGCTCGAGCAAAGTGTAATGGTTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-259s21c1
Sequence:CCGGGATTCCGCTGGGATTACTTATCTCGAGATAAGTAATCCCAGCGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-599s21c1
Sequence:CCGGCCCGACCTATTATCTACCTTACTCGAGTAAGGTAGATAATAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-1941s21c1
Sequence:CCGGGCATCTAGTAACTTGATTGAACTCGAGTTCAATCAAGTTACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-1020s21c1
Sequence:CCGGCCTAATCTAACGGTCTATAAACTCGAGTTTATAGACCGTTAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-1430s21c1
Sequence:CCGGAGAGGAATCGTACCCTTATTACTCGAGTAATAAGGGTACGATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-1941s1c1
Sequence:CCGGGCATCTAGTAACTTGATTGAACTCGAGTTCAATCAAGTTACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_032003.1-1304s1c1
Sequence:CCGGCCTGCCACACAATGGATCATTCTCGAGAATGATCCATTGTGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-508s1c1
Sequence:CCGGCCACACCAATATGGATCACAACTCGAGTTGTGATCCATATTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-1518s1c1
Sequence:CCGGCGCAGTCAAGTGCATACTTTACTCGAGTAAAGTATGCACTTGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-599s1c1
Sequence:CCGGCCCGACCTATTATCTACCTTACTCGAGTAAGGTAGATAATAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032003
VALIDATED
ENPP5 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-366s21c1
Sequence:CCGGTACCCTAACCATTACACTTTGCTCGAGCAAAGTGTAATGGTTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-259s21c1
Sequence:CCGGGATTCCGCTGGGATTACTTATCTCGAGATAAGTAATCCCAGCGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-599s21c1
Sequence:CCGGCCCGACCTATTATCTACCTTACTCGAGTAAGGTAGATAATAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_032003.1-1941s21c1
Sequence:CCGGGCATCTAGTAACTTGATTGAACTCGAGTTCAATCAAGTTACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-1020s21c1
Sequence:CCGGCCTAATCTAACGGTCTATAAACTCGAGTTTATAGACCGTTAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032003.1-1430s21c1
Sequence:CCGGAGAGGAATCGTACCCTTATTACTCGAGTAATAAGGGTACGATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-1941s1c1
Sequence:CCGGGCATCTAGTAACTTGATTGAACTCGAGTTCAATCAAGTTACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_032003.1-1304s1c1
Sequence:CCGGCCTGCCACACAATGGATCATTCTCGAGAATGATCCATTGTGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-508s1c1
Sequence:CCGGCCACACCAATATGGATCACAACTCGAGTTGTGATCCATATTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-1518s1c1
Sequence:CCGGCGCAGTCAAGTGCATACTTTACTCGAGTAAAGTATGCACTTGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_032003.1-599s1c1
Sequence:CCGGCCCGACCTATTATCTACCTTACTCGAGTAAGGTAGATAATAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021572
ENPP5 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021572.4-2120s21c1
Sequence:CCGGCCGAATAATGAACGTAGAAATCTCGAGATTTCTACGTTCATTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021572.4-1217s21c1
Sequence:CCGGGGCAACCACGGTTACGATAATCTCGAGATTATCGTAACCGTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-1108s1c1
Sequence:CCGGCGTTCCAGAAAGGTGGCATTACTCGAGTAATGCCACCTTTCTGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-322s1c1
Sequence:CCGGCCGTTGGGATTACTTATATAACTCGAGTTATATAAGTAATCCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-652s1c1
Sequence:CCGGGCGCTTTCCTACTCATTACATCTCGAGATGTAATGAGTAGGAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-1527s1c1
Sequence:CCGGGCAGCATTATAGTGATTGTATCTCGAGATACAATCACTATAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-567s1c1
Sequence:CCGGCGACACCAATATGGATCACAACTCGAGTTGTGATCCATATTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021572
ENPP5 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021572.4-2120s21c1
Sequence:CCGGCCGAATAATGAACGTAGAAATCTCGAGATTTCTACGTTCATTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021572.4-1217s21c1
Sequence:CCGGGGCAACCACGGTTACGATAATCTCGAGATTATCGTAACCGTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-1108s1c1
Sequence:CCGGCGTTCCAGAAAGGTGGCATTACTCGAGTAATGCCACCTTTCTGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-322s1c1
Sequence:CCGGCCGTTGGGATTACTTATATAACTCGAGTTATATAAGTAATCCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-652s1c1
Sequence:CCGGGCGCTTTCCTACTCATTACATCTCGAGATGTAATGAGTAGGAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-1527s1c1
Sequence:CCGGGCAGCATTATAGTGATTGTATCTCGAGATACAATCACTATAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-567s1c1
Sequence:CCGGCGACACCAATATGGATCACAACTCGAGTTGTGATCCATATTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021572
ENPP5 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021572.4-2120s21c1
Sequence:CCGGCCGAATAATGAACGTAGAAATCTCGAGATTTCTACGTTCATTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021572.4-1217s21c1
Sequence:CCGGGGCAACCACGGTTACGATAATCTCGAGATTATCGTAACCGTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-1108s1c1
Sequence:CCGGCGTTCCAGAAAGGTGGCATTACTCGAGTAATGCCACCTTTCTGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-322s1c1
Sequence:CCGGCCGTTGGGATTACTTATATAACTCGAGTTATATAAGTAATCCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-652s1c1
Sequence:CCGGGCGCTTTCCTACTCATTACATCTCGAGATGTAATGAGTAGGAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-1527s1c1
Sequence:CCGGGCAGCATTATAGTGATTGTATCTCGAGATACAATCACTATAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021572.4-567s1c1
Sequence:CCGGCGACACCAATATGGATCACAACTCGAGTTGTGATCCATATTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks