EMAIL THIS PAGE TO A FRIEND

ENPP6

ectonucleotide pyrophosphatase/phosphodiesterase 6

100 Gene Product Result for
Synonyms: NPP6
UniProtKB ID: Q6UWR7, Q4W5Q1, Q96M57
Gene ID:
Mouse(320981) ectonucleotide pyrophosphatase/phosphodiesterase 6
Rat(306460) ectonucleotide pyrophosphatase/phosphodiesterase 6
Zebrafish(791915) ectonucleotide pyrophosphatase/phosphodiesterase 6
cow(537431) ectonucleotide pyrophosphatase/phosphodiesterase 6
Horse(100058368) ectonucleotide pyrophosphatase/phosphodiesterase 6
domestic cat(101089347) ectonucleotide pyrophosphatase/phosphodiesterase 6
dog(475636) ectonucleotide pyrophosphatase/phosphodiesterase 6
chicken(422551) ectonucleotide pyrophosphatase/phosphodiesterase 6
sheep(101108718) ectonucleotide pyrophosphatase/phosphodiesterase 6
Domestic Rabbit(100354004) ectonucleotide pyrophosphatase/phosphodiesterase 6
naked mole-rat(101700078) ectonucleotide pyrophosphatase/phosphodiesterase 6
domestic guinea pig(100719132) ectonucleotide pyrophosphatase/phosphodiesterase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153343 Rosetta Predictions human pricing
NM_001107311 Rosetta Predictions rat pricing
NM_177304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138284 predicted 928
2 SASI_Hs01_00138285 predicted 799
3 SASI_Hs01_00138286 predicted 1016
4 SASI_Hs01_00138287 predicted 604
5 SASI_Hs01_00138288 predicted 1009
6 SASI_Hs01_00138289 predicted 375
7 SASI_Hs01_00138290 predicted 278
8 SASI_Hs01_00138291 predicted 343
9 SASI_Hs01_00138292 predicted 879
10 SASI_Hs01_00138293 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227585 predicted 912
2 SASI_Rn02_00227586 predicted 961
3 SASI_Rn02_00227587 predicted 631
4 SASI_Rn02_00227588 predicted 617
5 SASI_Rn02_00227589 predicted 1158
6 SASI_Rn02_00227590 predicted 916
7 SASI_Rn02_00227591 predicted 750
8 SASI_Rn02_00227592 predicted 289
9 SASI_Rn02_00227593 predicted 788
10 SASI_Rn02_00227594 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347377 predicted 430
2 SASI_Mm01_00032265 predicted 931
3 SASI_Mm01_00032266 predicted 436
4 SASI_Mm01_00032267 predicted 936
5 SASI_Mm01_00032268 predicted 937
6 SASI_Mm01_00032269 predicted 794
7 SASI_Mm01_00032270 predicted 992
8 SASI_Mm02_00347378 predicted 1156
9 SASI_Mm01_00032271 predicted 769
10 SASI_Mm01_00032272 predicted 529
11 SASI_Mm01_00032263 predicted 473
12 SASI_Mm01_00032264 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177304
ENPP6 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177304.2-1477s1c1
Sequence:CCGGGCCGTTAAAGTTGTGAATATACTCGAGTATATTCACAACTTTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-254s1c1
Sequence:CCGGCCTCTCCTATCCCAATTACTACTCGAGTAGTAATTGGGATAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-228s1c1
Sequence:CCGGGATTACTTGACTCCAGACTTTCTCGAGAAAGTCTGGAGTCAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-559s1c1
Sequence:CCGGGCGATGCTCTCGACTCATTAACTCGAGTTAATGAGTCGAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-1109s1c1
Sequence:CCGGCGGATATGACAACGAACTCATCTCGAGATGAGTTCGTTGTCATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177304
ENPP6 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177304.2-1477s1c1
Sequence:CCGGGCCGTTAAAGTTGTGAATATACTCGAGTATATTCACAACTTTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-254s1c1
Sequence:CCGGCCTCTCCTATCCCAATTACTACTCGAGTAGTAATTGGGATAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-228s1c1
Sequence:CCGGGATTACTTGACTCCAGACTTTCTCGAGAAAGTCTGGAGTCAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-559s1c1
Sequence:CCGGGCGATGCTCTCGACTCATTAACTCGAGTTAATGAGTCGAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-1109s1c1
Sequence:CCGGCGGATATGACAACGAACTCATCTCGAGATGAGTTCGTTGTCATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177304
ENPP6 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177304.2-1477s1c1
Sequence:CCGGGCCGTTAAAGTTGTGAATATACTCGAGTATATTCACAACTTTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-254s1c1
Sequence:CCGGCCTCTCCTATCCCAATTACTACTCGAGTAGTAATTGGGATAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-228s1c1
Sequence:CCGGGATTACTTGACTCCAGACTTTCTCGAGAAAGTCTGGAGTCAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-559s1c1
Sequence:CCGGGCGATGCTCTCGACTCATTAACTCGAGTTAATGAGTCGAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177304.2-1109s1c1
Sequence:CCGGCGGATATGACAACGAACTCATCTCGAGATGAGTTCGTTGTCATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153343
ENPP6 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153343.2-2157s1c1
Sequence:CCGGCCCTGCATATTGATGGACAAACTCGAGTTTGTCCATCAATATGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-364s1c1
Sequence:CCGGGCGTCAACAAAGACAGCCTAACTCGAGTTAGGCTGTCTTTGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-498s1c1
Sequence:CCGGCCCACCTACTGCCTAGAATATCTCGAGATATTCTAGGCAGTAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-150s1c1
Sequence:CCGGCGCTCAGACTACATCAGTGATCTCGAGATCACTGATGTAGTCTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-999s1c1
Sequence:CCGGCCTTTGACTTTAGTGGCTGATCTCGAGATCAGCCACTAAAGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-832s21c1
Sequence:CCGGGGACCGCCTGAACGTCATTATCTCGAGATAATGACGTTCAGGCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-861s21c1
Sequence:CCGGATCACGGAATGACCGACATTTCTCGAGAAATGTCGGTCATTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-1455s21c1
Sequence:CCGGTGCTTGCATAACTGATCATATCTCGAGATATGATCAGTTATGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153343
ENPP6 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153343.2-2157s1c1
Sequence:CCGGCCCTGCATATTGATGGACAAACTCGAGTTTGTCCATCAATATGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-364s1c1
Sequence:CCGGGCGTCAACAAAGACAGCCTAACTCGAGTTAGGCTGTCTTTGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-498s1c1
Sequence:CCGGCCCACCTACTGCCTAGAATATCTCGAGATATTCTAGGCAGTAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-150s1c1
Sequence:CCGGCGCTCAGACTACATCAGTGATCTCGAGATCACTGATGTAGTCTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-999s1c1
Sequence:CCGGCCTTTGACTTTAGTGGCTGATCTCGAGATCAGCCACTAAAGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-832s21c1
Sequence:CCGGGGACCGCCTGAACGTCATTATCTCGAGATAATGACGTTCAGGCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-861s21c1
Sequence:CCGGATCACGGAATGACCGACATTTCTCGAGAAATGTCGGTCATTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-1455s21c1
Sequence:CCGGTGCTTGCATAACTGATCATATCTCGAGATATGATCAGTTATGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153343
ENPP6 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153343.2-2157s1c1
Sequence:CCGGCCCTGCATATTGATGGACAAACTCGAGTTTGTCCATCAATATGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-364s1c1
Sequence:CCGGGCGTCAACAAAGACAGCCTAACTCGAGTTAGGCTGTCTTTGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-498s1c1
Sequence:CCGGCCCACCTACTGCCTAGAATATCTCGAGATATTCTAGGCAGTAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-150s1c1
Sequence:CCGGCGCTCAGACTACATCAGTGATCTCGAGATCACTGATGTAGTCTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153343.2-999s1c1
Sequence:CCGGCCTTTGACTTTAGTGGCTGATCTCGAGATCAGCCACTAAAGTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-832s21c1
Sequence:CCGGGGACCGCCTGAACGTCATTATCTCGAGATAATGACGTTCAGGCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-861s21c1
Sequence:CCGGATCACGGAATGACCGACATTTCTCGAGAAATGTCGGTCATTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153343.3-1455s21c1
Sequence:CCGGTGCTTGCATAACTGATCATATCTCGAGATATGATCAGTTATGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks