EMAIL THIS PAGE TO A FRIEND

ENPP7

ectonucleotide pyrophosphatase/phosphodiesterase 7

65 Gene Product Result for
Synonyms: ALK-SMase E-NPP 7 NPP-7
UniProtKB ID: Q6UWV6, Q6ZTS5, Q8IUS8
Gene ID:
Mouse(238011) ectonucleotide pyrophosphatase/phosphodiesterase 7
Rat(303729) ectonucleotide pyrophosphatase/phosphodiesterase 7
naked mole-rat(101723307) ectonucleotide pyrophosphatase/phosphodiesterase 7
sheep(101111726) ectonucleotide pyrophosphatase/phosphodiesterase 7
Zebrafish(100334069) ectonucleotide pyrophosphatase/phosphodiesterase 7
domestic cat(101085334) ectonucleotide pyrophosphatase/phosphodiesterase 7
dog(608627) ectonucleotide pyrophosphatase/phosphodiesterase 7
cow(505388) ectonucleotide pyrophosphatase/phosphodiesterase 7
chicken(426249) ectonucleotide pyrophosphatase/phosphodiesterase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1433 Human ENPP-7 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178543 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001030291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001030291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001030291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178543 Rosetta Predictions human pricing
NM_001012466 Rosetta Predictions rat pricing
XM_001081753 Rosetta Predictions rat pricing
NM_001030291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087570 predicted 477
2 SASI_Hs01_00087571 predicted 866
3 SASI_Hs01_00087572 predicted 1025
4 SASI_Hs01_00087573 predicted 494
5 SASI_Hs01_00087574 predicted 530
6 SASI_Hs01_00087575 predicted 1367
7 SASI_Hs02_00369778 predicted 391
8 SASI_Hs01_00087576 predicted 1044
9 SASI_Hs01_00087577 predicted 260
10 SASI_Hs01_00087578 predicted 1159
11 SASI_Hs01_00087569 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054301 predicted 999
2 SASI_Rn01_00054302 predicted 548
3 SASI_Rn02_00200569 predicted 924
4 SASI_Rn01_00054303 predicted 804
5 SASI_Rn01_00054304 predicted 859
6 SASI_Rn01_00054306 predicted 738
7 SASI_Rn01_00054307 predicted 1024
8 SASI_Rn01_00054308 predicted 461
9 SASI_Rn01_00054309 predicted 497
10 SASI_Rn02_00200570 predicted 274
11 SASI_Rn01_00054305 predicted 764
12 SASI_Rn01_00054310 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373305 predicted 562
2 SASI_Rn02_00373306 predicted 946
3 SASI_Rn02_00373307 predicted 818
4 SASI_Rn02_00373308 predicted 884
5 SASI_Rn02_00373309 predicted 821
6 SASI_Rn02_00373310 predicted 746
7 SASI_Rn02_00373311 predicted 556
8 SASI_Rn02_00373312 predicted 484
9 SASI_Rn02_00373313 predicted 383
10 SASI_Rn02_00373314 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092362 predicted 470
2 SASI_Mm01_00092363 predicted 459
3 SASI_Mm01_00092364 predicted 843
4 SASI_Mm01_00092365 predicted 1144
5 SASI_Mm01_00092366 predicted 603
6 SASI_Mm01_00092367 predicted 770
7 SASI_Mm01_00092369 predicted 786
8 SASI_Mm01_00092370 predicted 299
9 SASI_Mm01_00092371 predicted 483
10 SASI_Mm02_00288124 predicted 568
11 SASI_Mm01_00092368 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178543
ENPP7 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-261s21c1
Sequence:CCGGACCCTGGTCACCGGCAAATATCTCGAGATATTTGCCGGTGACCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-730s21c1
Sequence:CCGGACCGCCTCAACCTGATCATCACTCGAGTGATGATCAGGTTGAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-1377s21c1
Sequence:CCGGCTTCTGTCTGAGGTCGCATAACTCGAGTTATGCGACCTCAGACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-1033s21c1
Sequence:CCGGACGTCATCCATGGGAGAATTACTCGAGTAATTCTCCCATGGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178543.3-1558s21c1
Sequence:CCGGCTGTTATGGTGCTGGTAATAACTCGAGTTATTACCAGCACCATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-497s1c1
Sequence:CCGGAGAAGGCATCGCACACAACTACTCGAGTAGTTGTGTGCGATGCCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-1370s1c1
Sequence:CCGGCGTGATTCTTCTGTCTGAGGTCTCGAGACCTCAGACAGAAGAATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-818s1c1
Sequence:CCGGCAACTTCACCTTCCGGGACATCTCGAGATGTCCCGGAAGGTGAAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178543.x-1553s1c1
Sequence:CCGGCTTGGCTGTTATGGTGCTGGTCTCGAGACCAGCACCATAACAGCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178543
ENPP7 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-261s21c1
Sequence:CCGGACCCTGGTCACCGGCAAATATCTCGAGATATTTGCCGGTGACCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-730s21c1
Sequence:CCGGACCGCCTCAACCTGATCATCACTCGAGTGATGATCAGGTTGAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-1377s21c1
Sequence:CCGGCTTCTGTCTGAGGTCGCATAACTCGAGTTATGCGACCTCAGACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-1033s21c1
Sequence:CCGGACGTCATCCATGGGAGAATTACTCGAGTAATTCTCCCATGGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178543.3-1558s21c1
Sequence:CCGGCTGTTATGGTGCTGGTAATAACTCGAGTTATTACCAGCACCATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-497s1c1
Sequence:CCGGAGAAGGCATCGCACACAACTACTCGAGTAGTTGTGTGCGATGCCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-1370s1c1
Sequence:CCGGCGTGATTCTTCTGTCTGAGGTCTCGAGACCTCAGACAGAAGAATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-818s1c1
Sequence:CCGGCAACTTCACCTTCCGGGACATCTCGAGATGTCCCGGAAGGTGAAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178543.x-1553s1c1
Sequence:CCGGCTTGGCTGTTATGGTGCTGGTCTCGAGACCAGCACCATAACAGCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178543
ENPP7 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-261s21c1
Sequence:CCGGACCCTGGTCACCGGCAAATATCTCGAGATATTTGCCGGTGACCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-730s21c1
Sequence:CCGGACCGCCTCAACCTGATCATCACTCGAGTGATGATCAGGTTGAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-1377s21c1
Sequence:CCGGCTTCTGTCTGAGGTCGCATAACTCGAGTTATGCGACCTCAGACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178543.3-1033s21c1
Sequence:CCGGACGTCATCCATGGGAGAATTACTCGAGTAATTCTCCCATGGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178543.3-1558s21c1
Sequence:CCGGCTGTTATGGTGCTGGTAATAACTCGAGTTATTACCAGCACCATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-497s1c1
Sequence:CCGGAGAAGGCATCGCACACAACTACTCGAGTAGTTGTGTGCGATGCCTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-1370s1c1
Sequence:CCGGCGTGATTCTTCTGTCTGAGGTCTCGAGACCTCAGACAGAAGAATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178543.x-818s1c1
Sequence:CCGGCAACTTCACCTTCCGGGACATCTCGAGATGTCCCGGAAGGTGAAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178543.x-1553s1c1
Sequence:CCGGCTTGGCTGTTATGGTGCTGGTCTCGAGACCAGCACCATAACAGCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030291
ENPP7 MISSION shRNA Bacterial Glycerol Stock
ectonucleotide pyrophosphatase/phosphodiesterase 7
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-740s1c1
Sequence:CCGGCCTGATTATCACATCGGACCACTCGAGTGGTCCGATGTGATAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-1056s1c1
Sequence:CCGGGTCCAGTTCAACAATGGTGAACTCGAGTTCACCATTGTTGAACTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030291.1-803s1c1
Sequence:CCGGGTTCCACAAGTTCTCCAACTTCTCGAGAAGTTGGAGAACTTGTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-761s1c1
Sequence:CCGGCGGTATGACAACCGTCAACAACTCGAGTTGTTGACGGTTGTCATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-1163s1c1
Sequence:CCGGCTTCGAGAGTGTCCATGTGTACTCGAGTACACATGGACACTCTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-122s1c1
Sequence:CCGGCCTCGTATCCTTTGACGGATTCTCGAGAATCCGTCAAAGGATACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030291
ENPP7 MISSION shRNA shRNA Plasmid DNA
ectonucleotide pyrophosphatase/phosphodiesterase 7
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-740s1c1
Sequence:CCGGCCTGATTATCACATCGGACCACTCGAGTGGTCCGATGTGATAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-1056s1c1
Sequence:CCGGGTCCAGTTCAACAATGGTGAACTCGAGTTCACCATTGTTGAACTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030291.1-803s1c1
Sequence:CCGGGTTCCACAAGTTCTCCAACTTCTCGAGAAGTTGGAGAACTTGTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-761s1c1
Sequence:CCGGCGGTATGACAACCGTCAACAACTCGAGTTGTTGACGGTTGTCATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-1163s1c1
Sequence:CCGGCTTCGAGAGTGTCCATGTGTACTCGAGTACACATGGACACTCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-122s1c1
Sequence:CCGGCCTCGTATCCTTTGACGGATTCTCGAGAATCCGTCAAAGGATACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030291
ENPP7 MISSION shRNA Lentiviral Transduction Particles
ectonucleotide pyrophosphatase/phosphodiesterase 7
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-740s1c1
Sequence:CCGGCCTGATTATCACATCGGACCACTCGAGTGGTCCGATGTGATAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-1056s1c1
Sequence:CCGGGTCCAGTTCAACAATGGTGAACTCGAGTTCACCATTGTTGAACTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030291.1-803s1c1
Sequence:CCGGGTTCCACAAGTTCTCCAACTTCTCGAGAAGTTGGAGAACTTGTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-761s1c1
Sequence:CCGGCGGTATGACAACCGTCAACAACTCGAGTTGTTGACGGTTGTCATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-1163s1c1
Sequence:CCGGCTTCGAGAGTGTCCATGTGTACTCGAGTACACATGGACACTCTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001030291.1-122s1c1
Sequence:CCGGCCTCGTATCCTTTGACGGATTCTCGAGAATCCGTCAAAGGATACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)