EMAIL THIS PAGE TO A FRIEND

ENSA

endosulfine alpha

296 Gene Product Result for
Synonyms: ARPP-19e
Gene ID:
Human(2029) Summary: The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(56205) endosulfine alpha
Rat(60334) endosulfine alpha
chicken(425073) endosulfine alpha
cow(281142) endosulfine alpha
domestic cat(101085485) endosulfine alpha
dog(475837) endosulfine alpha
sheep(101107055) endosulfine alpha
naked mole-rat(101725556) endosulfine alpha
domestic guinea pig(100714626) endosulfine alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004436 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004436 Rosetta Predictions human pricing
NM_207042 Rosetta Predictions human pricing
NM_207043 Rosetta Predictions human pricing
NM_207044 Rosetta Predictions human pricing
NM_207045 Rosetta Predictions human pricing
NM_207046 Rosetta Predictions human pricing
NM_207047 Rosetta Predictions human pricing
NM_207168 Rosetta Predictions human pricing
NM_001033974 Rosetta Predictions rat pricing
NM_021842 Rosetta Predictions rat pricing
NM_001026212 Rosetta Predictions mouse pricing
NM_019561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156597 predicted 978
2 SASI_Hs01_00156598 predicted 396
3 SASI_Hs01_00156599 predicted 662
4 SASI_Hs01_00156600 predicted 905
5 SASI_Hs01_00156601 predicted 220
6 SASI_Hs01_00156602 predicted 639
7 SASI_Hs01_00156604 predicted 241
8 SASI_Hs01_00156605 predicted 309
9 SASI_Hs01_00156606 predicted 930
10 SASI_Hs02_00337608 predicted 534
11 SASI_Hs01_00156603 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244984 predicted 1025
2 SASI_Hs01_00244985 predicted 442
3 SASI_Hs01_00244986 predicted 709
4 SASI_Hs01_00244987 predicted 949
5 SASI_Hs01_00244988 predicted 215
6 SASI_Hs01_00244989 predicted 357
7 SASI_Hs01_00244990 predicted 689
8 SASI_Hs01_00244992 predicted 244
9 SASI_Hs01_00244993 predicted 979
10 SASI_Hs02_00373722 predicted 573
11 SASI_Hs01_00244991 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145923 predicted 890
2 SASI_Hs01_00145924 predicted 678
3 SASI_Hs01_00145925 predicted 916
4 SASI_Hs01_00145926 predicted 897
5 SASI_Hs01_00145927 predicted 989
6 SASI_Hs02_00373723 predicted 762
7 SASI_Hs01_00145930 predicted 643
8 SASI_Hs01_00145931 predicted 634
9 SASI_Hs01_00145932 predicted 782
10 SASI_Hs02_00373724 predicted 949
11 SASI_Hs01_00145928 predicted 658
12 SASI_Hs01_00145929 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169783 predicted 846
2 SASI_Hs01_00169784 predicted 630
3 SASI_Hs01_00169785 predicted 867
4 SASI_Hs01_00169786 predicted 846
5 SASI_Hs01_00169787 predicted 947
6 SASI_Hs02_00373725 predicted 716
7 SASI_Hs01_00169790 predicted 591
8 SASI_Hs01_00169791 predicted 585
9 SASI_Hs01_00169792 predicted 743
10 SASI_Hs02_00373726 predicted 904
11 SASI_Hs01_00169788 predicted 608
12 SASI_Hs01_00169789 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109325 predicted 889
2 SASI_Hs01_00109326 predicted 305
3 SASI_Hs01_00109327 predicted 565
4 SASI_Hs02_00373727 predicted 35
5 SASI_Hs01_00109328 predicted 809
6 SASI_Hs01_00109329 predicted 81
7 SASI_Hs01_00109330 predicted 212
8 SASI_Hs01_00109331 predicted 554
9 SASI_Hs01_00109333 predicted 102
10 SASI_Hs01_00109334 predicted 838
11 SASI_Hs01_00109332 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150328 predicted 837
2 SASI_Hs01_00150329 predicted 255
3 SASI_Hs01_00150330 predicted 518
4 SASI_Hs02_00373728 predicted 31
5 SASI_Hs01_00150331 predicted 769
6 SASI_Hs01_00150332 predicted 87
7 SASI_Hs01_00150333 predicted 503
8 SASI_Hs01_00150335 predicted 104
9 SASI_Hs01_00150336 predicted 167
10 SASI_Hs01_00150337 predicted 791
11 SASI_Hs01_00150334 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014633 predicted 711
2 SASI_Hs01_00014634 predicted 493
3 SASI_Hs01_00014635 predicted 732
4 SASI_Hs01_00014636 predicted 710
5 SASI_Hs01_00014637 predicted 806
6 SASI_Hs02_00373729 predicted 572
7 SASI_Hs01_00014640 predicted 453
8 SASI_Hs01_00014641 predicted 446
9 SASI_Hs01_00014642 predicted 603
10 SASI_Hs02_00373730 predicted 765
11 SASI_Hs01_00014638 predicted 471
12 SASI_Hs01_00014639 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071513 predicted 467
2 SASI_Hs01_00071514 predicted 353
3 SASI_Hs01_00071515 predicted 470
4 SASI_Hs02_00373793 predicted 444
5 SASI_Hs01_00071517 predicted 401
6 SASI_Hs01_00071518 predicted 489
7 SASI_Hs01_00071519 predicted 310
8 SASI_Hs01_00071520 predicted 224
9 SASI_Hs01_00071521 predicted 484
10 SASI_Hs01_00071522 predicted 236
11 SASI_Hs01_00071516 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099179 predicted 690
2 SASI_Rn01_00099180 predicted 575
3 SASI_Rn02_00203859 predicted 679
4 SASI_Rn02_00203860 predicted 204
5 SASI_Rn01_00099181 predicted 624
6 SASI_Rn01_00099182 predicted 833
7 SASI_Rn01_00099184 predicted 539
8 SASI_Rn01_00099185 predicted 338
9 SASI_Rn01_00099187 predicted 555
10 SASI_Rn02_00203861 predicted 682
11 SASI_Rn01_00099183 predicted 789
12 SASI_Rn01_00099186 predicted 637
13 SASI_Rn01_00099188 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097629 predicted 201
2 SASI_Rn01_00097630 predicted 247
3 SASI_Rn01_00097631 predicted 207
4 SASI_Rn01_00097632 predicted 194
5 SASI_Rn01_00097633 predicted 248
6 SASI_Rn01_00097634 predicted 224
7 SASI_Rn01_00097635 predicted 204
8 SASI_Rn01_00097636 predicted 222
9 SASI_Rn01_00097637 predicted 249
10 SASI_Rn01_00097638 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001026212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131689 predicted 865
2 SASI_Mm01_00131690 predicted 624
3 SASI_Mm01_00131691 predicted 546
4 SASI_Mm01_00131692 predicted 671
5 SASI_Mm01_00131693 predicted 911
6 SASI_Mm01_00131694 predicted 651
7 SASI_Mm01_00131695 predicted 611
8 SASI_Mm01_00131696 predicted 688
9 SASI_Mm01_00131697 predicted 559
10 SASI_Mm01_00131698 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135090 predicted 933
2 SASI_Mm01_00135091 predicted 476
3 SASI_Mm01_00135092 predicted 760
4 SASI_Mm01_00135093 predicted 852
5 SASI_Mm01_00135094 predicted 907
6 SASI_Mm01_00135095 predicted 1005
7 SASI_Mm01_00135096 predicted 829
8 SASI_Mm01_00135097 predicted 633
9 SASI_Mm01_00135098 predicted 919
10 SASI_Mm01_00135099 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019561
VALIDATED
ENSA MISSION shRNA Bacterial Glycerol Stock
endosulfine alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-213s1c1
Sequence:CCGGCATGGCCAAAGCCAAGATGAACTCGAGTTCATCTTGGCTTTGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-192s1c1
Sequence:CCGGCTTTGACTCAGGAGACTACAACTCGAGTTGTAGTCTCCTGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-189s1c1
Sequence:CCGGGTACTTTGACTCAGGAGACTACTCGAGTAGTCTCCTGAGTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019561.2-492s21c1
Sequence:CCGGGGCCAAGTTGAGTGATGCTTCCTCGAGGAAGCATCACTCAACTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.2-243s1c1
Sequence:CCGGGCAAAGCTAAAGGCCAAATATCTCGAGATATTTGGCCTTTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019561.2-1010s21c1
Sequence:CCGGAGTTGAGGATTTAGGATAAACCTCGAGGTTTATCCTAAATCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019561.2-404s21c1
Sequence:CCGGCAAGAACCTGGTGACCGGTGACTCGAGTCACCGGTCACCAGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019561.2-454s21c1
Sequence:CCGGAGAGAAAGTCCTCGCTCGTCACTCGAGTGACGAGCGAGGACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019561.2-307s21c1
Sequence:CCGGAGAGACTCCAGAAAGGGCAAACTCGAGTTTGCCCTTTCTGGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019561
VALIDATED
ENSA MISSION shRNA shRNA Plasmid DNA
endosulfine alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-213s1c1
Sequence:CCGGCATGGCCAAAGCCAAGATGAACTCGAGTTCATCTTGGCTTTGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-192s1c1
Sequence:CCGGCTTTGACTCAGGAGACTACAACTCGAGTTGTAGTCTCCTGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-189s1c1
Sequence:CCGGGTACTTTGACTCAGGAGACTACTCGAGTAGTCTCCTGAGTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019561.2-492s21c1
Sequence:CCGGGGCCAAGTTGAGTGATGCTTCCTCGAGGAAGCATCACTCAACTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.2-243s1c1
Sequence:CCGGGCAAAGCTAAAGGCCAAATATCTCGAGATATTTGGCCTTTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019561.2-1010s21c1
Sequence:CCGGAGTTGAGGATTTAGGATAAACCTCGAGGTTTATCCTAAATCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019561.2-404s21c1
Sequence:CCGGCAAGAACCTGGTGACCGGTGACTCGAGTCACCGGTCACCAGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019561.2-454s21c1
Sequence:CCGGAGAGAAAGTCCTCGCTCGTCACTCGAGTGACGAGCGAGGACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019561.2-307s21c1
Sequence:CCGGAGAGACTCCAGAAAGGGCAAACTCGAGTTTGCCCTTTCTGGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019561
VALIDATED
ENSA MISSION shRNA Lentiviral Transduction Particles
endosulfine alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-213s1c1
Sequence:CCGGCATGGCCAAAGCCAAGATGAACTCGAGTTCATCTTGGCTTTGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-192s1c1
Sequence:CCGGCTTTGACTCAGGAGACTACAACTCGAGTTGTAGTCTCCTGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.1-189s1c1
Sequence:CCGGGTACTTTGACTCAGGAGACTACTCGAGTAGTCTCCTGAGTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019561.2-492s21c1
Sequence:CCGGGGCCAAGTTGAGTGATGCTTCCTCGAGGAAGCATCACTCAACTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019561.2-243s1c1
Sequence:CCGGGCAAAGCTAAAGGCCAAATATCTCGAGATATTTGGCCTTTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019561.2-1010s21c1
Sequence:CCGGAGTTGAGGATTTAGGATAAACCTCGAGGTTTATCCTAAATCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019561.2-404s21c1
Sequence:CCGGCAAGAACCTGGTGACCGGTGACTCGAGTCACCGGTCACCAGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019561.2-454s21c1
Sequence:CCGGAGAGAAAGTCCTCGCTCGTCACTCGAGTGACGAGCGAGGACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019561.2-307s21c1
Sequence:CCGGAGAGACTCCAGAAAGGGCAAACTCGAGTTTGCCCTTTCTGGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004436
VALIDATED
ENSA MISSION shRNA Bacterial Glycerol Stock
endosulfine alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-506s1c1
Sequence:CCGGCTGCCAGATCCTGAGACGCTTCTCGAGAAGCGTCTCAGGATCTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-217s1c1
Sequence:CCGGGAGCTGAAGAGGCAAAGCTAACTCGAGTTAGCTTTGCCTCTTCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-198s1c1
Sequence:CCGGGAAGGTATTCTGCCTGAGAGACTCGAGTCTCTCAGGCAGAATACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-371s1c1
Sequence:CCGGGCCAAGTGCAGGACCAGACAACTCGAGTTGTCTGGTCCTGCACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-342s1c1
Sequence:CCGGGCCAAAGCCAAGATGAAGAATCTCGAGATTCTTCATCTTGGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-398s21c1
Sequence:CCGGGCCAAGTGCAGGACCAGACAACTCGAGTTGTCTGGTCCTGCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-369s21c1
Sequence:CCGGGCCAAAGCCAAGATGAAGAATCTCGAGATTCTTCATCTTGGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004436.2-809s21c1
Sequence:CCGGGATATGGAGGAGTATGAATTACTCGAGTAATTCATACTCCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-244s21c1
Sequence:CCGGGAGCTGAAGAGGCAAAGCTAACTCGAGTTAGCTTTGCCTCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004436
VALIDATED
ENSA MISSION shRNA shRNA Plasmid DNA
endosulfine alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-506s1c1
Sequence:CCGGCTGCCAGATCCTGAGACGCTTCTCGAGAAGCGTCTCAGGATCTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-217s1c1
Sequence:CCGGGAGCTGAAGAGGCAAAGCTAACTCGAGTTAGCTTTGCCTCTTCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-198s1c1
Sequence:CCGGGAAGGTATTCTGCCTGAGAGACTCGAGTCTCTCAGGCAGAATACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-371s1c1
Sequence:CCGGGCCAAGTGCAGGACCAGACAACTCGAGTTGTCTGGTCCTGCACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-342s1c1
Sequence:CCGGGCCAAAGCCAAGATGAAGAATCTCGAGATTCTTCATCTTGGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-398s21c1
Sequence:CCGGGCCAAGTGCAGGACCAGACAACTCGAGTTGTCTGGTCCTGCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-369s21c1
Sequence:CCGGGCCAAAGCCAAGATGAAGAATCTCGAGATTCTTCATCTTGGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004436.2-809s21c1
Sequence:CCGGGATATGGAGGAGTATGAATTACTCGAGTAATTCATACTCCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-244s21c1
Sequence:CCGGGAGCTGAAGAGGCAAAGCTAACTCGAGTTAGCTTTGCCTCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004436
VALIDATED
ENSA MISSION shRNA Lentiviral Transduction Particles
endosulfine alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-506s1c1
Sequence:CCGGCTGCCAGATCCTGAGACGCTTCTCGAGAAGCGTCTCAGGATCTGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-217s1c1
Sequence:CCGGGAGCTGAAGAGGCAAAGCTAACTCGAGTTAGCTTTGCCTCTTCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-198s1c1
Sequence:CCGGGAAGGTATTCTGCCTGAGAGACTCGAGTCTCTCAGGCAGAATACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-371s1c1
Sequence:CCGGGCCAAGTGCAGGACCAGACAACTCGAGTTGTCTGGTCCTGCACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004436.1-342s1c1
Sequence:CCGGGCCAAAGCCAAGATGAAGAATCTCGAGATTCTTCATCTTGGCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-398s21c1
Sequence:CCGGGCCAAGTGCAGGACCAGACAACTCGAGTTGTCTGGTCCTGCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-369s21c1
Sequence:CCGGGCCAAAGCCAAGATGAAGAATCTCGAGATTCTTCATCTTGGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004436.2-809s21c1
Sequence:CCGGGATATGGAGGAGTATGAATTACTCGAGTAATTCATACTCCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004436.2-244s21c1
Sequence:CCGGGAGCTGAAGAGGCAAAGCTAACTCGAGTTAGCTTTGCCTCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks