EMAIL THIS PAGE TO A FRIEND

ENTHD1

ENTH domain containing 1

Synonyms: CACNA1I dJ370M22.3
UniProtKB ID: Q8IYW4, B0QYD5, Q5H9F7, Q96LK3
Gene ID:
Mouse(383075) ENTH domain containing 1
Rat(685900) ENTH domain containing 1
Horse(100070380) ENTH domain containing 1
domestic cat(101097819) ENTH domain containing 1
dog(481242) ENTH domain containing 1
cow(538470) ENTH domain containing 1
domestic guinea pig(100736209) ENTH domain containing 1
naked mole-rat(101722986) ENTH domain containing 1
sheep(101101885) ENTH domain containing 1
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152512 Rosetta Predictions human pricing
XM_001065686 Rosetta Predictions rat pricing
XM_356844 Rosetta Predictions mouse pricing
XM_986112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146982 predicted 1182
2 SASI_Hs01_00146984 predicted 1282
3 SASI_Hs02_00366294 predicted 2116
4 SASI_Hs01_00146986 predicted 1705
5 SASI_Hs01_00146987 predicted 1402
6 SASI_Hs01_00146988 predicted 1255
7 SASI_Hs02_00366295 predicted 928
8 SASI_Hs01_00146989 predicted 796
9 SASI_Hs01_00146990 predicted 2066
10 SASI_Hs01_00146991 predicted 1047
11 SASI_Hs01_00146983 predicted 776
12 SASI_Hs01_00146985 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315023 predicted 219
2 SASI_Rn02_00315024 predicted 330
3 SASI_Rn02_00315025 predicted 9
4 SASI_Rn02_00315026 predicted 89
5 SASI_Rn02_00315027 predicted 9
6 SASI_Rn02_00315028 predicted 161
7 SASI_Rn02_00315029 predicted 251
8 SASI_Rn02_00315030 predicted 254
9 SASI_Rn02_00315031 predicted 318
10 SASI_Rn02_00315032 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235522 predicted 523
2 SASI_Mm01_00235524 predicted 519
3 SASI_Mm01_00235526 predicted 592
4 SASI_Mm01_00235527 predicted 609
5 SASI_Mm01_00235528 predicted 565
6 SASI_Mm01_00235529 predicted 636
7 SASI_Mm02_00425992 predicted 569
8 SASI_Mm02_00425993 predicted 651
9 SASI_Mm02_00425994 predicted 614
10 SASI_Mm02_00425995 predicted 607
11 SASI_Mm01_00235523 predicted 693
12 SASI_Mm01_00235525 predicted 747
13 SASI_Mm01_00235530 predicted 691
14 SASI_Mm01_00235531 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448976 predicted 528
2 SASI_Mm02_00448977 predicted 526
3 SASI_Mm02_00448978 predicted 593
4 SASI_Mm02_00448979 predicted 605
5 SASI_Mm02_00448980 predicted 561
6 SASI_Mm02_00448981 predicted 636
7 SASI_Mm02_00448982 predicted 576
8 SASI_Mm02_00448983 predicted 648
9 SASI_Mm02_00448984 predicted 618
10 SASI_Mm02_00448985 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152512
ENTHD1 MISSION shRNA Bacterial Glycerol Stock
ENTH domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-1144s21c1
Sequence:CCGGAGAGATCAGATGGTATCTTTACTCGAGTAAAGATACCATCTGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-472s21c1
Sequence:CCGGCCCTTACCCTAATGGATTATCCTCGAGGATAATCCATTAGGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-2057s21c1
Sequence:CCGGGAGCTCAGATCAGATCTAATCCTCGAGGATTAGATCTGATCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-596s1c1
Sequence:CCGGCCAAGGTTATTATATCCGGGACTCGAGTCCCGGATATAATAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-885s1c1
Sequence:CCGGGATGTTCATTTGCCTACAGAACTCGAGTTCTGTAGGCAAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-1551s1c1
Sequence:CCGGGCTCATCTCTTATCACCAATTCTCGAGAATTGGTGATAAGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-1928s1c1
Sequence:CCGGCGCTAGATTACATGAAGATCTCTCGAGAGATCTTCATGTAATCTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-880s1c1
Sequence:CCGGGCCAAGATGTTCATTTGCCTACTCGAGTAGGCAAATGAACATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152512.3-2121s1c1
Sequence:CCGGCCCAAGACTTACGTTAGCATTCTCGAGAATGCTAACGTAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-858s1c1
Sequence:CCGGGCAGGATTGAAACAAGAGCATCTCGAGATGCTCTTGTTTCAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152512.3-2334s1c1
Sequence:CCGGGCTCTGTACCTCAAATGGGTTCTCGAGAACCCATTTGAGGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152512
ENTHD1 MISSION shRNA shRNA Plasmid DNA
ENTH domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-1144s21c1
Sequence:CCGGAGAGATCAGATGGTATCTTTACTCGAGTAAAGATACCATCTGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-472s21c1
Sequence:CCGGCCCTTACCCTAATGGATTATCCTCGAGGATAATCCATTAGGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-2057s21c1
Sequence:CCGGGAGCTCAGATCAGATCTAATCCTCGAGGATTAGATCTGATCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-596s1c1
Sequence:CCGGCCAAGGTTATTATATCCGGGACTCGAGTCCCGGATATAATAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-885s1c1
Sequence:CCGGGATGTTCATTTGCCTACAGAACTCGAGTTCTGTAGGCAAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-1551s1c1
Sequence:CCGGGCTCATCTCTTATCACCAATTCTCGAGAATTGGTGATAAGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-1928s1c1
Sequence:CCGGCGCTAGATTACATGAAGATCTCTCGAGAGATCTTCATGTAATCTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-880s1c1
Sequence:CCGGGCCAAGATGTTCATTTGCCTACTCGAGTAGGCAAATGAACATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152512.3-2121s1c1
Sequence:CCGGCCCAAGACTTACGTTAGCATTCTCGAGAATGCTAACGTAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-858s1c1
Sequence:CCGGGCAGGATTGAAACAAGAGCATCTCGAGATGCTCTTGTTTCAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152512.3-2334s1c1
Sequence:CCGGGCTCTGTACCTCAAATGGGTTCTCGAGAACCCATTTGAGGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152512
ENTHD1 MISSION shRNA Lentiviral Transduction Particles
ENTH domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-1144s21c1
Sequence:CCGGAGAGATCAGATGGTATCTTTACTCGAGTAAAGATACCATCTGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-472s21c1
Sequence:CCGGCCCTTACCCTAATGGATTATCCTCGAGGATAATCCATTAGGGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152512.3-2057s21c1
Sequence:CCGGGAGCTCAGATCAGATCTAATCCTCGAGGATTAGATCTGATCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-596s1c1
Sequence:CCGGCCAAGGTTATTATATCCGGGACTCGAGTCCCGGATATAATAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-885s1c1
Sequence:CCGGGATGTTCATTTGCCTACAGAACTCGAGTTCTGTAGGCAAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-1551s1c1
Sequence:CCGGGCTCATCTCTTATCACCAATTCTCGAGAATTGGTGATAAGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152512.3-1928s1c1
Sequence:CCGGCGCTAGATTACATGAAGATCTCTCGAGAGATCTTCATGTAATCTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-880s1c1
Sequence:CCGGGCCAAGATGTTCATTTGCCTACTCGAGTAGGCAAATGAACATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152512.3-2121s1c1
Sequence:CCGGCCCAAGACTTACGTTAGCATTCTCGAGAATGCTAACGTAAGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152512.3-858s1c1
Sequence:CCGGGCAGGATTGAAACAAGAGCATCTCGAGATGCTCTTGTTTCAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152512.3-2334s1c1
Sequence:CCGGGCTCTGTACCTCAAATGGGTTCTCGAGAACCCATTTGAGGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163189
ENTHD1 MISSION shRNA Bacterial Glycerol Stock
ENTH domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1180s21c1
Sequence:CCGGGTCCAAGTCTGAGTCCATATTCTCGAGAATATGGACTCAGACTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1468s21c1
Sequence:CCGGCCGGTGCTTTATCCCGGTTATCTCGAGATAACCGGGATAAAGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1131s21c1
Sequence:CCGGCATTCTGGCCATCAGGTAAAGCTCGAGCTTTACCTGATGGCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-403s21c1
Sequence:CCGGGGGCGTCTGTAACCTTCAAATCTCGAGATTTGAAGGTTACAGACGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-807s21c1
Sequence:CCGGTTGGGATGAAGGCGTGGAAATCTCGAGATTTCCACGCCTTCATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163189
ENTHD1 MISSION shRNA shRNA Plasmid DNA
ENTH domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1180s21c1
Sequence:CCGGGTCCAAGTCTGAGTCCATATTCTCGAGAATATGGACTCAGACTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1468s21c1
Sequence:CCGGCCGGTGCTTTATCCCGGTTATCTCGAGATAACCGGGATAAAGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1131s21c1
Sequence:CCGGCATTCTGGCCATCAGGTAAAGCTCGAGCTTTACCTGATGGCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-403s21c1
Sequence:CCGGGGGCGTCTGTAACCTTCAAATCTCGAGATTTGAAGGTTACAGACGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-807s21c1
Sequence:CCGGTTGGGATGAAGGCGTGGAAATCTCGAGATTTCCACGCCTTCATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163189
ENTHD1 MISSION shRNA Lentiviral Transduction Particles
ENTH domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1180s21c1
Sequence:CCGGGTCCAAGTCTGAGTCCATATTCTCGAGAATATGGACTCAGACTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1468s21c1
Sequence:CCGGCCGGTGCTTTATCCCGGTTATCTCGAGATAACCGGGATAAAGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-1131s21c1
Sequence:CCGGCATTCTGGCCATCAGGTAAAGCTCGAGCTTTACCTGATGGCCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-403s21c1
Sequence:CCGGGGGCGTCTGTAACCTTCAAATCTCGAGATTTGAAGGTTACAGACGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163189.1-807s21c1
Sequence:CCGGTTGGGATGAAGGCGTGGAAATCTCGAGATTTCCACGCCTTCATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks