EMAIL THIS PAGE TO A FRIEND

ENTHD2

ENTH domain containing 2

78 Gene Product Result for
Synonyms: C17orf56
UniProtKB ID: Q96N21, Q6ZQU0, Q6ZSQ9
Gene ID:
Mouse(78777) ENTH domain containing 2
Rat(360673) ENTH domain containing 2
sheep(101109630) ENTH domain containing 2
naked mole-rat(101698692) ENTH domain containing 2
domestic guinea pig(100735259) ENTH domain containing 2
Zebrafish(100148088) ENTH domain containing 2
dog(608257) ENTH domain containing 2
domestic cat(101096686) ENTH domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144679 Rosetta Predictions human pricing
XM_001074705 Rosetta Predictions rat pricing
XM_001081796 Rosetta Predictions rat pricing
XM_001081797 Rosetta Predictions rat pricing
XM_340946 Rosetta Predictions rat pricing
NM_183137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058149 predicted 1754
2 SASI_Hs01_00058150 predicted 1661
3 SASI_Hs01_00058151 predicted 1853
4 SASI_Hs01_00058152 predicted 613
5 SASI_Hs01_00058153 predicted 1684
6 SASI_Hs01_00058154 predicted 1896
7 SASI_Hs01_00058155 predicted 1864
8 SASI_Hs01_00058156 predicted 1859
9 SASI_Hs01_00058157 predicted 358
10 SASI_Hs01_00058158 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347085 predicted 1313
2 SASI_Rn02_00347086 predicted 533
3 SASI_Rn02_00347087 predicted 388
4 SASI_Rn02_00347088 predicted 1517
5 SASI_Rn02_00347089 predicted 1075
6 SASI_Rn02_00347090 predicted 1228
7 SASI_Rn02_00347091 predicted 1593
8 SASI_Rn02_00347092 predicted 821
9 SASI_Rn02_00347093 predicted 377
10 SASI_Rn02_00347094 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373532 predicted 1316
2 SASI_Rn02_00373533 predicted 533
3 SASI_Rn02_00373534 predicted 384
4 SASI_Rn02_00373535 predicted 1517
5 SASI_Rn02_00373536 predicted 1073
6 SASI_Rn02_00373537 predicted 1224
7 SASI_Rn02_00373538 predicted 1595
8 SASI_Rn02_00373539 predicted 818
9 SASI_Rn02_00373540 predicted 377
10 SASI_Rn02_00373541 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373542 predicted 1521
2 SASI_Rn02_00373543 predicted 533
3 SASI_Rn02_00373544 predicted 1722
4 SASI_Rn02_00373545 predicted 1278
5 SASI_Rn02_00373546 predicted 531
6 SASI_Rn02_00373547 predicted 1429
7 SASI_Rn02_00373548 predicted 1796
8 SASI_Rn02_00373549 predicted 648
9 SASI_Rn02_00373550 predicted 739
10 SASI_Rn02_00373551 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392150 predicted 1519
2 SASI_Rn02_00392151 predicted 532
3 SASI_Rn02_00392152 predicted 1721
4 SASI_Rn02_00392153 predicted 1275
5 SASI_Rn02_00392154 predicted 527
6 SASI_Rn02_00392155 predicted 1429
7 SASI_Rn02_00392156 predicted 1799
8 SASI_Rn02_00392157 predicted 646
9 SASI_Rn02_00392158 predicted 747
10 SASI_Rn02_00392159 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185885 predicted 386
2 SASI_Mm02_00350145 predicted 2048
3 SASI_Mm02_00350146 predicted 1275
4 SASI_Mm02_00350147 predicted 2015
5 SASI_Mm02_00350148 predicted 266
6 SASI_Mm02_00350149 predicted 2026
7 SASI_Mm02_00350150 predicted 1721
8 SASI_Mm01_00185889 predicted 384
9 SASI_Mm02_00350151 predicted 1031
10 SASI_Mm01_00185894 predicted 278
11 SASI_Mm01_00185886 predicted 236
12 SASI_Mm01_00185887 predicted 1248
13 SASI_Mm01_00185888 predicted 957
14 SASI_Mm01_00185890 predicted 645
15 SASI_Mm01_00185891 predicted 369
16 SASI_Mm01_00185892 predicted 1004
17 SASI_Mm01_00185893 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183137
VALIDATED
ENTHD2 MISSION shRNA Bacterial Glycerol Stock
ENTH domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.1-230s1c1
Sequence:CCGGCGTGAAGCTCAAGGTGGTAAACTCGAGTTTACCACCTTGAGCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.1-948s1c1
Sequence:CCGGCCAAATGACTGCCAGCAAGAACTCGAGTTCTTGCTGGCAGTCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183137.1-1253s1c1
Sequence:CCGGCCACCAAGATCCTGAGACATTCTCGAGAATGTCTCAGGATCTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.2-381s1c1
Sequence:CCGGCAGATCCTCTTCACGGAAATACTCGAGTATTTCCGTGAAGAGGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-382s21c1
Sequence:CCGGAGATCCTCTTCACGGAAATAGCTCGAGCTATTTCCGTGAAGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-259s21c1
Sequence:CCGGCGTGAAGCTCAAGGTGCTAAACTCGAGTTTAGCACCTTGAGCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-644s21c1
Sequence:CCGGGTGCGTCCTGGACCTGATAATCTCGAGATTATCAGGTCCAGGACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183137.2-2339s21c1
Sequence:CCGGGCTAGGTGCTGGCAATGATTGCTCGAGCAATCATTGCCAGCACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183137
VALIDATED
ENTHD2 MISSION shRNA shRNA Plasmid DNA
ENTH domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.1-230s1c1
Sequence:CCGGCGTGAAGCTCAAGGTGGTAAACTCGAGTTTACCACCTTGAGCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.1-948s1c1
Sequence:CCGGCCAAATGACTGCCAGCAAGAACTCGAGTTCTTGCTGGCAGTCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183137.1-1253s1c1
Sequence:CCGGCCACCAAGATCCTGAGACATTCTCGAGAATGTCTCAGGATCTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.2-381s1c1
Sequence:CCGGCAGATCCTCTTCACGGAAATACTCGAGTATTTCCGTGAAGAGGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-382s21c1
Sequence:CCGGAGATCCTCTTCACGGAAATAGCTCGAGCTATTTCCGTGAAGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-259s21c1
Sequence:CCGGCGTGAAGCTCAAGGTGCTAAACTCGAGTTTAGCACCTTGAGCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-644s21c1
Sequence:CCGGGTGCGTCCTGGACCTGATAATCTCGAGATTATCAGGTCCAGGACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183137.2-2339s21c1
Sequence:CCGGGCTAGGTGCTGGCAATGATTGCTCGAGCAATCATTGCCAGCACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183137
VALIDATED
ENTHD2 MISSION shRNA Lentiviral Transduction Particles
ENTH domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.1-230s1c1
Sequence:CCGGCGTGAAGCTCAAGGTGGTAAACTCGAGTTTACCACCTTGAGCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.1-948s1c1
Sequence:CCGGCCAAATGACTGCCAGCAAGAACTCGAGTTCTTGCTGGCAGTCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183137.1-1253s1c1
Sequence:CCGGCCACCAAGATCCTGAGACATTCTCGAGAATGTCTCAGGATCTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183137.2-381s1c1
Sequence:CCGGCAGATCCTCTTCACGGAAATACTCGAGTATTTCCGTGAAGAGGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-382s21c1
Sequence:CCGGAGATCCTCTTCACGGAAATAGCTCGAGCTATTTCCGTGAAGAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-259s21c1
Sequence:CCGGCGTGAAGCTCAAGGTGCTAAACTCGAGTTTAGCACCTTGAGCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183137.2-644s21c1
Sequence:CCGGGTGCGTCCTGGACCTGATAATCTCGAGATTATCAGGTCCAGGACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183137.2-2339s21c1
Sequence:CCGGGCTAGGTGCTGGCAATGATTGCTCGAGCAATCATTGCCAGCACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144679
ENTHD2 MISSION shRNA Bacterial Glycerol Stock
ENTH domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144679.1-1862s1c1
Sequence:CCGGCCCTCAGACATGAGGTTTCTTCTCGAGAAGAAACCTCATGTCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-287s1c1
Sequence:CCGGCTCATCCTCAAACGCAACTCTCTCGAGAGAGTTGCGTTTGAGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-1048s1c1
Sequence:CCGGCAAGATCCTGAGGCACTTTGACTCGAGTCAAAGTGCCTCAGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-238s1c1
Sequence:CCGGGCTGAAGATCCTGCTCTATCTCTCGAGAGATAGAGCAGGATCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160395    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144679.1-1870s1c1
Sequence:CCGGCATGAGGTTTCTTGTATGAATCTCGAGATTCATACAAGAAACCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-815s1c1
Sequence:CCGGGAGGCACAGCACTTCATCAAACTCGAGTTTGATGAAGTGCTGTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-236s1c1
Sequence:CCGGGTGCTGAAGATCCTGCTCTATCTCGAGATAGAGCAGGATCTTCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-226s1c1
Sequence:CCGGGAAGCTCAAGGTGCTGAAGATCTCGAGATCTTCAGCACCTTGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144679.1-286s21c1
Sequence:CCGGGCTCATCCTCAAACGCAACTCCTCGAGGAGTTGCGTTTGAGGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144679.1-1898s21c1
Sequence:CCGGCGACTACCAGGTTCCTTATTTCTCGAGAAATAAGGAACCTGGTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144679
ENTHD2 MISSION shRNA shRNA Plasmid DNA
ENTH domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144679.1-1862s1c1
Sequence:CCGGCCCTCAGACATGAGGTTTCTTCTCGAGAAGAAACCTCATGTCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-287s1c1
Sequence:CCGGCTCATCCTCAAACGCAACTCTCTCGAGAGAGTTGCGTTTGAGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-1048s1c1
Sequence:CCGGCAAGATCCTGAGGCACTTTGACTCGAGTCAAAGTGCCTCAGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-238s1c1
Sequence:CCGGGCTGAAGATCCTGCTCTATCTCTCGAGAGATAGAGCAGGATCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160395    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144679.1-1870s1c1
Sequence:CCGGCATGAGGTTTCTTGTATGAATCTCGAGATTCATACAAGAAACCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-815s1c1
Sequence:CCGGGAGGCACAGCACTTCATCAAACTCGAGTTTGATGAAGTGCTGTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-236s1c1
Sequence:CCGGGTGCTGAAGATCCTGCTCTATCTCGAGATAGAGCAGGATCTTCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-226s1c1
Sequence:CCGGGAAGCTCAAGGTGCTGAAGATCTCGAGATCTTCAGCACCTTGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144679.1-286s21c1
Sequence:CCGGGCTCATCCTCAAACGCAACTCCTCGAGGAGTTGCGTTTGAGGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144679.1-1898s21c1
Sequence:CCGGCGACTACCAGGTTCCTTATTTCTCGAGAAATAAGGAACCTGGTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144679
ENTHD2 MISSION shRNA Lentiviral Transduction Particles
ENTH domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144679.1-1862s1c1
Sequence:CCGGCCCTCAGACATGAGGTTTCTTCTCGAGAAGAAACCTCATGTCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-287s1c1
Sequence:CCGGCTCATCCTCAAACGCAACTCTCTCGAGAGAGTTGCGTTTGAGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-1048s1c1
Sequence:CCGGCAAGATCCTGAGGCACTTTGACTCGAGTCAAAGTGCCTCAGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-238s1c1
Sequence:CCGGGCTGAAGATCCTGCTCTATCTCTCGAGAGATAGAGCAGGATCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160395    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144679.1-1870s1c1
Sequence:CCGGCATGAGGTTTCTTGTATGAATCTCGAGATTCATACAAGAAACCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-815s1c1
Sequence:CCGGGAGGCACAGCACTTCATCAAACTCGAGTTTGATGAAGTGCTGTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-236s1c1
Sequence:CCGGGTGCTGAAGATCCTGCTCTATCTCGAGATAGAGCAGGATCTTCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144679.1-226s1c1
Sequence:CCGGGAAGCTCAAGGTGCTGAAGATCTCGAGATCTTCAGCACCTTGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144679.1-286s21c1
Sequence:CCGGGCTCATCCTCAAACGCAACTCCTCGAGGAGTTGCGTTTGAGGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144679.1-1898s21c1
Sequence:CCGGCGACTACCAGGTTCCTTATTTCTCGAGAAATAAGGAACCTGGTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)