EMAIL THIS PAGE TO A FRIEND

ENTPD1

ectonucleoside triphosphate diphosphohydrolase 1

94 Gene Product Result for
Synonyms: ATPDase CD39 NTPDase-1
Gene ID:
Mouse(12495) ectonucleoside triphosphate diphosphohydrolase 1
Rat(64519) ectonucleoside triphosphate diphosphohydrolase 1
Zebrafish(445151) ectonucleoside triphosphate diphosphohydrolase 1
dog(486810) ectonucleoside triphosphate diphosphohydrolase 1
cow(282223) ectonucleoside triphosphate diphosphohydrolase 1
Horse(100070956) ectonucleoside triphosphate diphosphohydrolase 1
domestic cat(101096356) ectonucleoside triphosphate diphosphohydrolase 1
chicken(423826) ectonucleoside triphosphate diphosphohydrolase 1
domestic guinea pig(100717436) ectonucleoside triphosphate diphosphohydrolase 1
naked mole-rat(101715301) ectonucleoside triphosphate diphosphohydrolase 1
sheep(101109842) ectonucleoside triphosphate diphosphohydrolase 1
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098175 Rosetta Predictions human pricing
NM_001776 Rosetta Predictions human pricing
NM_022587 Rosetta Predictions rat pricing
NM_009848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318598 predicted 1619
2 SASI_Hs02_00318599 predicted 436
3 SASI_Hs02_00318600 predicted 493
4 SASI_Hs02_00318601 predicted 913
5 SASI_Hs02_00318602 predicted 1145
6 SASI_Hs02_00318603 predicted 1148
7 SASI_Hs02_00318604 predicted 1051
8 SASI_Hs02_00318605 predicted 1134
9 SASI_Hs02_00318606 predicted 1481
10 SASI_Hs02_00318607 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011076 predicted 1896
2 SASI_Hs01_00011077 predicted 707
3 SASI_Hs01_00011078 predicted 774
4 SASI_Hs01_00011079 predicted 1075
5 SASI_Hs01_00011080 predicted 1185
6 SASI_Hs02_00332527 predicted 1419
7 SASI_Hs01_00011082 predicted 1316
8 SASI_Hs01_00011083 predicted 1404
9 SASI_Hs02_00332528 predicted 1761
10 SASI_Hs01_00011084 predicted 1052
11 SASI_Hs01_00011081 predicted 1037
12 SASI_Hs01_00011085 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042937 predicted 1259
2 SASI_Rn01_00042938 predicted 781
3 SASI_Rn01_00042939 predicted 922
4 SASI_Rn01_00042940 predicted 655
5 SASI_Rn01_00042942 predicted 997
6 SASI_Rn01_00042943 predicted 303
7 SASI_Rn01_00042944 predicted 563
8 SASI_Rn01_00042945 predicted 1271
9 SASI_Rn01_00042946 predicted 604
10 SASI_Rn02_00263330 predicted 329
11 SASI_Rn01_00042941 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023257 predicted 1168
2 SASI_Mm01_00023258 predicted 322
3 SASI_Mm01_00023259 predicted 804
4 SASI_Mm01_00023260 predicted 680
5 SASI_Mm01_00023261 predicted 819
6 SASI_Mm01_00023262 predicted 936
7 SASI_Mm01_00023263 predicted 621
8 SASI_Mm01_00023264 predicted 910
9 SASI_Mm02_00317230 predicted 1463
10 SASI_Mm02_00317231 predicted 1463
11 SASI_Mm01_00023265 predicted 926
12 SASI_Mm01_00023266 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001776
ENTPD1 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.5-1590s21c1
Sequence:CCGGCCTTCTGCAAGGCTATCATTTCTCGAGAAATGATAGCCTTGCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-1276s21c1
Sequence:GTACCGGGACATTCAGGTTGCAAGTAATCTCGAGATTACTTGCAACCTGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001776.4-2736s21c1
Sequence:CCGGCTATGAGGTAGGTGGTATATACTCGAGTATATACCACCTACCTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001776.5-2283s21c1
Sequence:CCGGTCCTGTTTGCCATCCATTAAGCTCGAGCTTAATGGATGGCAAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-831s21c1
Sequence:CCGGGCACCAAGAGACACCCGTTTACTCGAGTAAACGGGTGTCTCTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-1315s21c1
Sequence:CCGGTGCTTTCATCCTGGATATAAGCTCGAGCTTATATCCAGGATGAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-997s21c1
Sequence:CCGGGCCTATGGCTGGATTACTATCCTCGAGGATAGTAATCCAGCCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.5-386s21c1
Sequence:CCGGTTGGCTTCTCCTCTATCATAGCTCGAGCTATGATAGAGGAGAAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1017s1c1
Sequence:CCGGGCAGTTTGAAATCCAGGGTATCTCGAGATACCCTGGATTTCAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-777s1c1
Sequence:CCGGCCCAGATAATGCTCTGCAATTCTCGAGAATTGCAGAGCATTATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1284s1c1
Sequence:CCGGCGCTGGAGTAAAGGAGAAGTACTCGAGTACTTCTCCTTTACTCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1585s1c1
Sequence:CCGGCCTTCATATTTCTGGAAAGATCTCGAGATCTTTCCAGAAATATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-151s1c1
Sequence:CCGGTCCTCTATCATAGCTGTGATACTCGAGTATCACAGCTATGATAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001776
ENTPD1 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.5-1590s21c1
Sequence:CCGGCCTTCTGCAAGGCTATCATTTCTCGAGAAATGATAGCCTTGCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-1276s21c1
Sequence:GTACCGGGACATTCAGGTTGCAAGTAATCTCGAGATTACTTGCAACCTGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001776.4-2736s21c1
Sequence:CCGGCTATGAGGTAGGTGGTATATACTCGAGTATATACCACCTACCTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001776.5-2283s21c1
Sequence:CCGGTCCTGTTTGCCATCCATTAAGCTCGAGCTTAATGGATGGCAAACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-831s21c1
Sequence:CCGGGCACCAAGAGACACCCGTTTACTCGAGTAAACGGGTGTCTCTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-1315s21c1
Sequence:CCGGTGCTTTCATCCTGGATATAAGCTCGAGCTTATATCCAGGATGAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-997s21c1
Sequence:CCGGGCCTATGGCTGGATTACTATCCTCGAGGATAGTAATCCAGCCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.5-386s21c1
Sequence:CCGGTTGGCTTCTCCTCTATCATAGCTCGAGCTATGATAGAGGAGAAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1017s1c1
Sequence:CCGGGCAGTTTGAAATCCAGGGTATCTCGAGATACCCTGGATTTCAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-777s1c1
Sequence:CCGGCCCAGATAATGCTCTGCAATTCTCGAGAATTGCAGAGCATTATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1284s1c1
Sequence:CCGGCGCTGGAGTAAAGGAGAAGTACTCGAGTACTTCTCCTTTACTCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1585s1c1
Sequence:CCGGCCTTCATATTTCTGGAAAGATCTCGAGATCTTTCCAGAAATATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-151s1c1
Sequence:CCGGTCCTCTATCATAGCTGTGATACTCGAGTATCACAGCTATGATAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001776
ENTPD1 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.5-1590s21c1
Sequence:CCGGCCTTCTGCAAGGCTATCATTTCTCGAGAAATGATAGCCTTGCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-1276s21c1
Sequence:GTACCGGGACATTCAGGTTGCAAGTAATCTCGAGATTACTTGCAACCTGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001776.4-2736s21c1
Sequence:CCGGCTATGAGGTAGGTGGTATATACTCGAGTATATACCACCTACCTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001776.5-2283s21c1
Sequence:CCGGTCCTGTTTGCCATCCATTAAGCTCGAGCTTAATGGATGGCAAACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-831s21c1
Sequence:CCGGGCACCAAGAGACACCCGTTTACTCGAGTAAACGGGTGTCTCTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-1315s21c1
Sequence:CCGGTGCTTTCATCCTGGATATAAGCTCGAGCTTATATCCAGGATGAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.4-997s21c1
Sequence:CCGGGCCTATGGCTGGATTACTATCCTCGAGGATAGTAATCCAGCCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001776.5-386s21c1
Sequence:CCGGTTGGCTTCTCCTCTATCATAGCTCGAGCTATGATAGAGGAGAAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1017s1c1
Sequence:CCGGGCAGTTTGAAATCCAGGGTATCTCGAGATACCCTGGATTTCAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-777s1c1
Sequence:CCGGCCCAGATAATGCTCTGCAATTCTCGAGAATTGCAGAGCATTATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1284s1c1
Sequence:CCGGCGCTGGAGTAAAGGAGAAGTACTCGAGTACTTCTCCTTTACTCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-1585s1c1
Sequence:CCGGCCTTCATATTTCTGGAAAGATCTCGAGATCTTTCCAGAAATATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001776.3-151s1c1
Sequence:CCGGTCCTCTATCATAGCTGTGATACTCGAGTATCACAGCTATGATAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009848
ENTPD1 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-929s1c1
Sequence:CCGGCCCATGCTTTAACCCAGGATACTCGAGTATCCTGGGTTAAAGCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-889s1c1
Sequence:CCGGCCAAGGACATTCAGGTTTCAACTCGAGTTGAAACCTGAATGTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-152s1c1
Sequence:CCGGCCTTGGTTTCACCTCTATCTTCTCGAGAAGATAGAGGTGAAACCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-430s1c1
Sequence:CCGGCCGAACTGATACCAACATCCACTCGAGTGGATGTTGGTATCAGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-1387s1c1
Sequence:CCGGGCTCCTGGGAACAGATTCATTCTCGAGAATGAATCTGTTCCCAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009848
ENTPD1 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-929s1c1
Sequence:CCGGCCCATGCTTTAACCCAGGATACTCGAGTATCCTGGGTTAAAGCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-889s1c1
Sequence:CCGGCCAAGGACATTCAGGTTTCAACTCGAGTTGAAACCTGAATGTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-152s1c1
Sequence:CCGGCCTTGGTTTCACCTCTATCTTCTCGAGAAGATAGAGGTGAAACCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-430s1c1
Sequence:CCGGCCGAACTGATACCAACATCCACTCGAGTGGATGTTGGTATCAGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-1387s1c1
Sequence:CCGGGCTCCTGGGAACAGATTCATTCTCGAGAATGAATCTGTTCCCAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009848
ENTPD1 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-929s1c1
Sequence:CCGGCCCATGCTTTAACCCAGGATACTCGAGTATCCTGGGTTAAAGCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-889s1c1
Sequence:CCGGCCAAGGACATTCAGGTTTCAACTCGAGTTGAAACCTGAATGTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-152s1c1
Sequence:CCGGCCTTGGTTTCACCTCTATCTTCTCGAGAAGATAGAGGTGAAACCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-430s1c1
Sequence:CCGGCCGAACTGATACCAACATCCACTCGAGTGGATGTTGGTATCAGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009848.2-1387s1c1
Sequence:CCGGGCTCCTGGGAACAGATTCATTCTCGAGAATGAATCTGTTCCCAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)