EMAIL THIS PAGE TO A FRIEND

ENTPD2

ectonucleoside triphosphate diphosphohydrolase 2

76 Gene Product Result for
Synonyms: CD39L1 NTPDase-2
UniProtKB ID: Q9Y5L3, O15464, Q5SPY6
Gene ID:
Human(954) Summary: The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(12496) ectonucleoside triphosphate diphosphohydrolase 2
Rat(64467) ectonucleoside triphosphate diphosphohydrolase 2
chicken(395797) ectonucleoside triphosphate diphosphohydrolase 2
domestic cat(101100604) ectonucleoside triphosphate diphosphohydrolase 2
dog(491241) ectonucleoside triphosphate diphosphohydrolase 2
cow(100126045) ectonucleoside triphosphate diphosphohydrolase 2
naked mole-rat(101726023) ectonucleoside triphosphate diphosphohydrolase 2
domestic guinea pig(100716835) ectonucleoside triphosphate diphosphohydrolase 2
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A265 ARL 67156 trisodium salt hydrate ≥98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001246 Rosetta Predictions human pricing
NM_203468 Rosetta Predictions human pricing
NM_172030 Rosetta Predictions rat pricing
NM_009849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090238 predicted 419
2 SASI_Hs01_00090239 predicted 569
3 SASI_Hs01_00090240 predicted 477
4 SASI_Hs01_00090242 predicted 205
5 SASI_Hs01_00090243 predicted 347
6 SASI_Hs01_00090244 predicted 461
7 SASI_Hs01_00090245 predicted 522
8 SASI_Hs02_00331422 predicted 751
9 SASI_Hs01_00090246 predicted 662
10 SASI_Hs02_00331423 predicted 419
11 SASI_Hs01_00090237 predicted 666
12 SASI_Hs01_00090241 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086071 predicted 421
2 SASI_Hs01_00086072 predicted 566
3 SASI_Hs01_00086073 predicted 485
4 SASI_Hs01_00086075 predicted 206
5 SASI_Hs01_00086076 predicted 355
6 SASI_Hs01_00086077 predicted 459
7 SASI_Hs01_00086078 predicted 525
8 SASI_Hs02_00373403 predicted 756
9 SASI_Hs01_00086079 predicted 668
10 SASI_Hs02_00373404 predicted 425
11 SASI_Hs01_00086070 predicted 675
12 SASI_Hs01_00086074 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119392 predicted 688
2 SASI_Rn01_00119393 predicted 1572
3 SASI_Rn01_00119394 predicted 676
4 SASI_Rn01_00119395 predicted 1014
5 SASI_Rn01_00119396 predicted 710
6 SASI_Rn01_00119397 predicted 621
7 SASI_Rn01_00119398 predicted 1119
8 SASI_Rn01_00119399 predicted 699
9 SASI_Rn01_00119400 predicted 1138
10 SASI_Rn02_00269118 predicted 1317
11 SASI_Rn01_00119401 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163867 predicted 932
2 SASI_Mm02_00317232 predicted 1658
3 SASI_Mm01_00163869 predicted 753
4 SASI_Mm02_00317233 predicted 1324
5 SASI_Mm01_00163871 predicted 1699
6 SASI_Mm01_00163872 predicted 1210
7 SASI_Mm01_00163873 predicted 715
8 SASI_Mm01_00163874 predicted 797
9 SASI_Mm01_00163875 predicted 418
10 SASI_Mm01_00163876 predicted 375
11 SASI_Mm01_00163868 predicted 1247
12 SASI_Mm01_00163870 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001246
ENTPD2 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-432s1c1
Sequence:CCGGCGCCTGCTCAACCTGACCAATCTCGAGATTGGTCAGGTTGAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-1454s1c1
Sequence:CCGGCAAGCTGCCAAGCACCATTTACTCGAGTAAATGGTGCTTGGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-755s1c1
Sequence:CCGGCCGAGTCTACACCCACAGCTTCTCGAGAAGCTGTGGGTGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-206s1c1
Sequence:CCGGCACGTCCATGTTTATCTACAACTCGAGTTGTAGATAAACATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-1028s1c1
Sequence:CCGGCTTCTCCCGATGCTCTTTCAACTCGAGTTGAAAGAGCATCGGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-1453s21c1
Sequence:CCGGCCAAGCTGCCAAGCACCATTTCTCGAGAAATGGTGCTTGGCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-1030s21c1
Sequence:CCGGTCTCCCGATGCTCTTTCAATGCTCGAGCATTGAAAGAGCATCGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-243s21c1
Sequence:CCGGGAGAACGACACAGGCATTGTGCTCGAGCACAATGCCTGTGTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001246
ENTPD2 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-432s1c1
Sequence:CCGGCGCCTGCTCAACCTGACCAATCTCGAGATTGGTCAGGTTGAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-1454s1c1
Sequence:CCGGCAAGCTGCCAAGCACCATTTACTCGAGTAAATGGTGCTTGGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-755s1c1
Sequence:CCGGCCGAGTCTACACCCACAGCTTCTCGAGAAGCTGTGGGTGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-206s1c1
Sequence:CCGGCACGTCCATGTTTATCTACAACTCGAGTTGTAGATAAACATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-1028s1c1
Sequence:CCGGCTTCTCCCGATGCTCTTTCAACTCGAGTTGAAAGAGCATCGGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-1453s21c1
Sequence:CCGGCCAAGCTGCCAAGCACCATTTCTCGAGAAATGGTGCTTGGCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-1030s21c1
Sequence:CCGGTCTCCCGATGCTCTTTCAATGCTCGAGCATTGAAAGAGCATCGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-243s21c1
Sequence:CCGGGAGAACGACACAGGCATTGTGCTCGAGCACAATGCCTGTGTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001246
ENTPD2 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-432s1c1
Sequence:CCGGCGCCTGCTCAACCTGACCAATCTCGAGATTGGTCAGGTTGAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-1454s1c1
Sequence:CCGGCAAGCTGCCAAGCACCATTTACTCGAGTAAATGGTGCTTGGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-755s1c1
Sequence:CCGGCCGAGTCTACACCCACAGCTTCTCGAGAAGCTGTGGGTGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-206s1c1
Sequence:CCGGCACGTCCATGTTTATCTACAACTCGAGTTGTAGATAAACATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001246.2-1028s1c1
Sequence:CCGGCTTCTCCCGATGCTCTTTCAACTCGAGTTGAAAGAGCATCGGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-1453s21c1
Sequence:CCGGCCAAGCTGCCAAGCACCATTTCTCGAGAAATGGTGCTTGGCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-1030s21c1
Sequence:CCGGTCTCCCGATGCTCTTTCAATGCTCGAGCATTGAAAGAGCATCGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001246.2-243s21c1
Sequence:CCGGGAGAACGACACAGGCATTGTGCTCGAGCACAATGCCTGTGTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009849
VALIDATED
ENTPD2 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-652s1c1
Sequence:CCGGCCTTTGAGACAACCAGTCCATCTCGAGATGGACTGGTTGTCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-552s1c1
Sequence:CCGGCTGGAGAACTTCATCAAGTATCTCGAGATACTTGATGAAGTTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-274s1c1
Sequence:CCGGGCTACGCAAATGACCCTTCTACTCGAGTAGAAGGGTCATTTGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009849.1-1228s1c1
Sequence:CCGGCCATGTTCATACATCAGCTATCTCGAGATAGCTGATGTATGAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-1038s1c1
Sequence:CCGGGCTGGGAACTTCATAGCCTTTCTCGAGAAAGGCTATGAAGTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009849.2-1677s21c1
Sequence:CCGGCACTCACAGAAAGTCTACATGCTCGAGCATGTAGACTTTCTGTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009849.2-1424s21c1
Sequence:CCGGTGAATTTGACCAACCTGATTCCTCGAGGAATCAGGTTGGTCAAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009849.2-1793s21c1
Sequence:CCGGGCCTCTGTTCTGATTGATCTTCTCGAGAAGATCAATCAGAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009849.2-415s21c1
Sequence:CCGGGATGTGCCCAAAGACAGATATCTCGAGATATCTGTCTTTGGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009849
VALIDATED
ENTPD2 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-652s1c1
Sequence:CCGGCCTTTGAGACAACCAGTCCATCTCGAGATGGACTGGTTGTCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-552s1c1
Sequence:CCGGCTGGAGAACTTCATCAAGTATCTCGAGATACTTGATGAAGTTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-274s1c1
Sequence:CCGGGCTACGCAAATGACCCTTCTACTCGAGTAGAAGGGTCATTTGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009849.1-1228s1c1
Sequence:CCGGCCATGTTCATACATCAGCTATCTCGAGATAGCTGATGTATGAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-1038s1c1
Sequence:CCGGGCTGGGAACTTCATAGCCTTTCTCGAGAAAGGCTATGAAGTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009849.2-1677s21c1
Sequence:CCGGCACTCACAGAAAGTCTACATGCTCGAGCATGTAGACTTTCTGTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009849.2-1424s21c1
Sequence:CCGGTGAATTTGACCAACCTGATTCCTCGAGGAATCAGGTTGGTCAAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009849.2-1793s21c1
Sequence:CCGGGCCTCTGTTCTGATTGATCTTCTCGAGAAGATCAATCAGAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009849.2-415s21c1
Sequence:CCGGGATGTGCCCAAAGACAGATATCTCGAGATATCTGTCTTTGGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009849
VALIDATED
ENTPD2 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-652s1c1
Sequence:CCGGCCTTTGAGACAACCAGTCCATCTCGAGATGGACTGGTTGTCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-552s1c1
Sequence:CCGGCTGGAGAACTTCATCAAGTATCTCGAGATACTTGATGAAGTTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-274s1c1
Sequence:CCGGGCTACGCAAATGACCCTTCTACTCGAGTAGAAGGGTCATTTGCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009849.1-1228s1c1
Sequence:CCGGCCATGTTCATACATCAGCTATCTCGAGATAGCTGATGTATGAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009849.1-1038s1c1
Sequence:CCGGGCTGGGAACTTCATAGCCTTTCTCGAGAAAGGCTATGAAGTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009849.2-1677s21c1
Sequence:CCGGCACTCACAGAAAGTCTACATGCTCGAGCATGTAGACTTTCTGTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009849.2-1424s21c1
Sequence:CCGGTGAATTTGACCAACCTGATTCCTCGAGGAATCAGGTTGGTCAAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009849.2-1793s21c1
Sequence:CCGGGCCTCTGTTCTGATTGATCTTCTCGAGAAGATCAATCAGAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009849.2-415s21c1
Sequence:CCGGGATGTGCCCAAAGACAGATATCTCGAGATATCTGTCTTTGGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks