EMAIL THIS PAGE TO A FRIEND

ENTPD3

ectonucleoside triphosphate diphosphohydrolase 3

149 Gene Product Result for
Synonyms: CD39L3 HB6 NTPDase-3
UniProtKB ID: O75355, B2R8D0, O60495
Gene ID:
Human(956) Summary: ENTPD3 is similar to E-type nucleotidases (NTPases). NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD3 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jul 2008]
Mouse(215446) ectonucleoside triphosphate diphosphohydrolase 3
Rat(316077) ectonucleoside triphosphate diphosphohydrolase 3
Zebrafish(100005551) ectonucleoside triphosphate diphosphohydrolase 3
domestic cat(101098083) ectonucleoside triphosphate diphosphohydrolase 3
cow(506087) ectonucleoside triphosphate diphosphohydrolase 3
Horse(100068004) ectonucleoside triphosphate diphosphohydrolase 3
dog(485604) ectonucleoside triphosphate diphosphohydrolase 3
chicken(428447) ectonucleoside triphosphate diphosphohydrolase 3
domestic guinea pig(100733912) ectonucleoside triphosphate diphosphohydrolase 3
naked mole-rat(101696417) ectonucleoside triphosphate diphosphohydrolase 3
sheep(101114471) ectonucleoside triphosphate diphosphohydrolase 3
Domestic Rabbit(100339644) ectonucleoside triphosphate diphosphohydrolase 3
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017071 MISSION® esiRNA esiRNA targeting human ENTPD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001248 Rosetta Predictions human pricing
NM_178106 Rosetta Predictions rat pricing
NM_178676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166194 predicted 953
2 SASI_Hs01_00166195 predicted 1372
3 SASI_Hs01_00166196 predicted 305
4 SASI_Hs01_00166197 predicted 1391
5 SASI_Hs01_00166198 predicted 792
6 SASI_Hs01_00166199 predicted 421
7 SASI_Hs01_00166200 predicted 652
8 SASI_Hs01_00166201 predicted 347
9 SASI_Hs01_00166202 predicted 575
10 SASI_Hs01_00166203 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089416 predicted 1649
2 SASI_Rn01_00089418 predicted 885
3 SASI_Rn02_00269636 predicted 413
4 SASI_Rn01_00089419 predicted 1498
5 SASI_Rn01_00089420 predicted 1311
6 SASI_Rn01_00089421 predicted 946
7 SASI_Rn01_00089422 predicted 966
8 SASI_Rn01_00089423 predicted 484
9 SASI_Rn01_00089424 predicted 1725
10 SASI_Rn01_00089425 predicted 766
11 SASI_Rn01_00089417 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023187 predicted 444
2 SASI_Mm01_00023189 predicted 384
3 SASI_Mm01_00023190 predicted 1280
4 SASI_Mm01_00023191 predicted 787
5 SASI_Mm01_00023193 predicted 1487
6 SASI_Mm01_00023194 predicted 1232
7 SASI_Mm02_00349138 predicted 313
8 SASI_Mm02_00349139 predicted 1004
9 SASI_Mm02_00349140 predicted 1108
10 SASI_Mm02_00349141 predicted 1073
11 SASI_Mm01_00023188 predicted 330
12 SASI_Mm01_00023192 predicted 1611
13 SASI_Mm01_00023195 predicted 616
14 SASI_Mm01_00023196 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001248
ENTPD3 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001248.2-650s21c1
Sequence:CCGGATGGATTACAGCCAACTATTTCTCGAGAAATAGTTGGCTGTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001248.2-1891s21c1
Sequence:CCGGCTACCCACATGCTGATCTATTCTCGAGAATAGATCAGCATGTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001248.2-954s21c1
Sequence:CCGGCCCTGTTACCCTCGGGATTATCTCGAGATAATCCCGAGGGTAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1163s1c1
Sequence:CCGGCCAAAGATTAAAGGGCCATTTCTCGAGAAATGGCCCTTTAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-239s1c1
Sequence:CCGGCCAGGACTGAAGTATGGTATTCTCGAGAATACCATACTTCAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1644s1c1
Sequence:CCGGCCTTTGACCATGCAGTGGATTCTCGAGAATCCACTGCATGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1369s1c1
Sequence:CCGGCCACTTGTTTGTGAACGGTTACTCGAGTAACCGTTCACAAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-650s1c1
Sequence:CCGGGCCAACTATTTAATGGGAAATCTCGAGATTTCCCATTAAATAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001248
ENTPD3 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001248.2-650s21c1
Sequence:CCGGATGGATTACAGCCAACTATTTCTCGAGAAATAGTTGGCTGTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001248.2-1891s21c1
Sequence:CCGGCTACCCACATGCTGATCTATTCTCGAGAATAGATCAGCATGTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001248.2-954s21c1
Sequence:CCGGCCCTGTTACCCTCGGGATTATCTCGAGATAATCCCGAGGGTAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1163s1c1
Sequence:CCGGCCAAAGATTAAAGGGCCATTTCTCGAGAAATGGCCCTTTAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-239s1c1
Sequence:CCGGCCAGGACTGAAGTATGGTATTCTCGAGAATACCATACTTCAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1644s1c1
Sequence:CCGGCCTTTGACCATGCAGTGGATTCTCGAGAATCCACTGCATGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1369s1c1
Sequence:CCGGCCACTTGTTTGTGAACGGTTACTCGAGTAACCGTTCACAAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-650s1c1
Sequence:CCGGGCCAACTATTTAATGGGAAATCTCGAGATTTCCCATTAAATAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001248
ENTPD3 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001248.2-650s21c1
Sequence:CCGGATGGATTACAGCCAACTATTTCTCGAGAAATAGTTGGCTGTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001248.2-1891s21c1
Sequence:CCGGCTACCCACATGCTGATCTATTCTCGAGAATAGATCAGCATGTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001248.2-954s21c1
Sequence:CCGGCCCTGTTACCCTCGGGATTATCTCGAGATAATCCCGAGGGTAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1163s1c1
Sequence:CCGGCCAAAGATTAAAGGGCCATTTCTCGAGAAATGGCCCTTTAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-239s1c1
Sequence:CCGGCCAGGACTGAAGTATGGTATTCTCGAGAATACCATACTTCAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1644s1c1
Sequence:CCGGCCTTTGACCATGCAGTGGATTCTCGAGAATCCACTGCATGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-1369s1c1
Sequence:CCGGCCACTTGTTTGTGAACGGTTACTCGAGTAACCGTTCACAAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001248.1-650s1c1
Sequence:CCGGGCCAACTATTTAATGGGAAATCTCGAGATTTCCCATTAAATAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178676
ENTPD3 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178676.2-2456s1c1
Sequence:CCGGCCCTAAATACAGAGTCCCTATCTCGAGATAGGGACTCTGTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-609s1c1
Sequence:CCGGTGGATGGATTACAGCCAACTACTCGAGTAGTTGGCTGTAATCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-574s1c1
Sequence:CCGGGCTCAAATCATTTCTGGGCAACTCGAGTTGCCCAGAAATGATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-1069s1c1
Sequence:CCGGGCTTCTGTGTTTGACTTCAATCTCGAGATTGAAGTCAAACACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-1558s1c1
Sequence:CCGGCTGGCATTTCTTCTGTATCTACTCGAGTAGATACAGAAGAAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178676
ENTPD3 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178676.2-2456s1c1
Sequence:CCGGCCCTAAATACAGAGTCCCTATCTCGAGATAGGGACTCTGTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-609s1c1
Sequence:CCGGTGGATGGATTACAGCCAACTACTCGAGTAGTTGGCTGTAATCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-574s1c1
Sequence:CCGGGCTCAAATCATTTCTGGGCAACTCGAGTTGCCCAGAAATGATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-1069s1c1
Sequence:CCGGGCTTCTGTGTTTGACTTCAATCTCGAGATTGAAGTCAAACACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-1558s1c1
Sequence:CCGGCTGGCATTTCTTCTGTATCTACTCGAGTAGATACAGAAGAAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178676
ENTPD3 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178676.2-2456s1c1
Sequence:CCGGCCCTAAATACAGAGTCCCTATCTCGAGATAGGGACTCTGTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-609s1c1
Sequence:CCGGTGGATGGATTACAGCCAACTACTCGAGTAGTTGGCTGTAATCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-574s1c1
Sequence:CCGGGCTCAAATCATTTCTGGGCAACTCGAGTTGCCCAGAAATGATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-1069s1c1
Sequence:CCGGGCTTCTGTGTTTGACTTCAATCTCGAGATTGAAGTCAAACACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178676.2-1558s1c1
Sequence:CCGGCTGGCATTTCTTCTGTATCTACTCGAGTAGATACAGAAGAAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks