EMAIL THIS PAGE TO A FRIEND

ENTPD4

ectonucleoside triphosphate diphosphohydrolase 4

71 Gene Product Result for
Synonyms: LALP70 LAP70 LYSAL1 NTPDase-4 UDPase
UniProtKB ID: Q9Y227, D3DSS3, O15092
Gene ID:
Human(9583) Summary: This gene encodes a member of the apyrase protein family. Apyrases are enzymes that catalyze the hydrolysis of nucleotide diphosphates and triphosphates in a calcium or magnesium-dependent manner. The encoded protein is an endo-apyrase and may play a role in salvaging nucleotides from lysosomes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and these isoforms may differ in divalent cation dependence and substrate specificity. [provided by RefSeq, Sep 2011]
Mouse(67464) ectonucleoside triphosphate diphosphohydrolase 4
Rat(361063) ectonucleoside triphosphate diphosphohydrolase 4
Zebrafish(436692) ectonucleoside triphosphate diphosphohydrolase 4
domestic cat(101085117) ectonucleoside triphosphate diphosphohydrolase 4
cow(531411) ectonucleoside triphosphate diphosphohydrolase 4
Horse(100053982) ectonucleoside triphosphate diphosphohydrolase 4
dog(486117) ectonucleoside triphosphate diphosphohydrolase 4
chicken(419531) ectonucleoside triphosphate diphosphohydrolase 4
sheep(101120555) ectonucleoside triphosphate diphosphohydrolase 4
Domestic Rabbit(100345399) ectonucleoside triphosphate diphosphohydrolase 4
naked mole-rat(101700645) ectonucleoside triphosphate diphosphohydrolase 4
domestic guinea pig(100730248) ectonucleoside triphosphate diphosphohydrolase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004901 Rosetta Predictions human pricing
NM_001108384 Rosetta Predictions rat pricing
NM_026174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084204 predicted 1503
2 SASI_Hs01_00084205 predicted 611
3 SASI_Hs02_00338549 predicted 1505
4 SASI_Hs01_00084206 predicted 1116
5 SASI_Hs02_00338550 predicted 248
6 SASI_Hs01_00084208 predicted 235
7 SASI_Hs01_00084209 predicted 1171
8 SASI_Hs01_00084210 predicted 578
9 SASI_Hs01_00084212 predicted 831
10 SASI_Hs01_00084213 predicted 792
11 SASI_Hs01_00084207 predicted 345
12 SASI_Hs01_00084211 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238129 predicted 1181
2 SASI_Rn02_00238130 predicted 1099
3 SASI_Rn02_00238131 predicted 293
4 SASI_Rn02_00238132 predicted 871
5 SASI_Rn02_00238133 predicted 838
6 SASI_Rn02_00238134 predicted 894
7 SASI_Rn02_00238135 predicted 890
8 SASI_Rn02_00238136 predicted 279
9 SASI_Rn02_00238137 predicted 296
10 SASI_Rn02_00238138 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029810 predicted 871
2 SASI_Mm01_00029811 predicted 1890
3 SASI_Mm01_00029812 predicted 1663
4 SASI_Mm01_00029813 predicted 283
5 SASI_Mm01_00029814 predicted 1208
6 SASI_Mm01_00029815 predicted 2105
7 SASI_Mm01_00029816 predicted 270
8 SASI_Mm01_00029817 predicted 291
9 SASI_Mm01_00029818 predicted 1758
10 SASI_Mm01_00029819 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026174
VALIDATED
ENTPD4 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026174.1-2136s1c1
Sequence:CCGGCCCTTTCCTTTCTGTTACAAACTCGAGTTTGTAACAGAAAGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-386s1c1
Sequence:CCGGGCTGTCAAAGGACAAGAAATTCTCGAGAATTTCTTGTCCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-942s1c1
Sequence:CCGGGCGGTTGTGGAAGTCAACATTCTCGAGAATGTTGACTTCCACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026174.1-1469s1c1
Sequence:CCGGCCACTTCCAGAACAGTGAATTCTCGAGAATTCACTGTTCTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-279s1c1
Sequence:CCGGCGAATTCTGAACACCAATTTACTCGAGTAAATTGGTGTTCAGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026174
VALIDATED
ENTPD4 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026174.1-2136s1c1
Sequence:CCGGCCCTTTCCTTTCTGTTACAAACTCGAGTTTGTAACAGAAAGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-386s1c1
Sequence:CCGGGCTGTCAAAGGACAAGAAATTCTCGAGAATTTCTTGTCCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-942s1c1
Sequence:CCGGGCGGTTGTGGAAGTCAACATTCTCGAGAATGTTGACTTCCACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026174.1-1469s1c1
Sequence:CCGGCCACTTCCAGAACAGTGAATTCTCGAGAATTCACTGTTCTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-279s1c1
Sequence:CCGGCGAATTCTGAACACCAATTTACTCGAGTAAATTGGTGTTCAGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026174
VALIDATED
ENTPD4 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026174.1-2136s1c1
Sequence:CCGGCCCTTTCCTTTCTGTTACAAACTCGAGTTTGTAACAGAAAGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-386s1c1
Sequence:CCGGGCTGTCAAAGGACAAGAAATTCTCGAGAATTTCTTGTCCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-942s1c1
Sequence:CCGGGCGGTTGTGGAAGTCAACATTCTCGAGAATGTTGACTTCCACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026174.1-1469s1c1
Sequence:CCGGCCACTTCCAGAACAGTGAATTCTCGAGAATTCACTGTTCTGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026174.1-279s1c1
Sequence:CCGGCGAATTCTGAACACCAATTTACTCGAGTAAATTGGTGTTCAGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004901
ENTPD4 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-332s1c1
Sequence:CCGGCGAAATAAGTATGGGCGACTACTCGAGTAGTCGCCCATACTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-1278s1c1
Sequence:CCGGCCCTAGACATTAAAGATGAAACTCGAGTTTCATCTTTAATGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-1649s1c1
Sequence:CCGGGCCTGGATGTTTGAGGTGTTTCTCGAGAAACACCTCAAACATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-579s1c1
Sequence:CCGGCGGGCATTTCAGAATTTGCTACTCGAGTAGCAAATTCTGAAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-868s1c1
Sequence:CCGGCCTTGGACGATTTGAGCATATCTCGAGATATGCTCAAATCGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-1677s21c1
Sequence:CCGGTCGTTTCCTGTCAACTATAAACTCGAGTTTATAGTTGACAGGAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004901.3-2459s21c1
Sequence:CCGGGTCTAGAAGTATTGCGTTTAGCTCGAGCTAAACGCAATACTTCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-865s21c1
Sequence:CCGGTTGGACGATTTGAGCATATTGCTCGAGCAATATGCTCAAATCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-314s21c1
Sequence:CCGGTGTTGTCATAATCCGAAATAACTCGAGTTATTTCGGATTATGACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-256s21c1
Sequence:CCGGTACGCCAAATTATGGTCATTACTCGAGTAATGACCATAATTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004901
ENTPD4 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-332s1c1
Sequence:CCGGCGAAATAAGTATGGGCGACTACTCGAGTAGTCGCCCATACTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-1278s1c1
Sequence:CCGGCCCTAGACATTAAAGATGAAACTCGAGTTTCATCTTTAATGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-1649s1c1
Sequence:CCGGGCCTGGATGTTTGAGGTGTTTCTCGAGAAACACCTCAAACATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-579s1c1
Sequence:CCGGCGGGCATTTCAGAATTTGCTACTCGAGTAGCAAATTCTGAAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-868s1c1
Sequence:CCGGCCTTGGACGATTTGAGCATATCTCGAGATATGCTCAAATCGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-1677s21c1
Sequence:CCGGTCGTTTCCTGTCAACTATAAACTCGAGTTTATAGTTGACAGGAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004901.3-2459s21c1
Sequence:CCGGGTCTAGAAGTATTGCGTTTAGCTCGAGCTAAACGCAATACTTCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-865s21c1
Sequence:CCGGTTGGACGATTTGAGCATATTGCTCGAGCAATATGCTCAAATCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-314s21c1
Sequence:CCGGTGTTGTCATAATCCGAAATAACTCGAGTTATTTCGGATTATGACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-256s21c1
Sequence:CCGGTACGCCAAATTATGGTCATTACTCGAGTAATGACCATAATTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004901
ENTPD4 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-332s1c1
Sequence:CCGGCGAAATAAGTATGGGCGACTACTCGAGTAGTCGCCCATACTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-1278s1c1
Sequence:CCGGCCCTAGACATTAAAGATGAAACTCGAGTTTCATCTTTAATGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-1649s1c1
Sequence:CCGGGCCTGGATGTTTGAGGTGTTTCTCGAGAAACACCTCAAACATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-579s1c1
Sequence:CCGGCGGGCATTTCAGAATTTGCTACTCGAGTAGCAAATTCTGAAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004901.1-868s1c1
Sequence:CCGGCCTTGGACGATTTGAGCATATCTCGAGATATGCTCAAATCGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-1677s21c1
Sequence:CCGGTCGTTTCCTGTCAACTATAAACTCGAGTTTATAGTTGACAGGAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004901.3-2459s21c1
Sequence:CCGGGTCTAGAAGTATTGCGTTTAGCTCGAGCTAAACGCAATACTTCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-865s21c1
Sequence:CCGGTTGGACGATTTGAGCATATTGCTCGAGCAATATGCTCAAATCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-314s21c1
Sequence:CCGGTGTTGTCATAATCCGAAATAACTCGAGTTATTTCGGATTATGACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004901.3-256s21c1
Sequence:CCGGTACGCCAAATTATGGTCATTACTCGAGTAATGACCATAATTTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks