EMAIL THIS PAGE TO A FRIEND

ENTPD5

ectonucleoside triphosphate diphosphohydrolase 5

105 Gene Product Result for
Synonyms: CD39L4 NTPDase-5 PCPH
UniProtKB ID: O75356, A1L4C5, Q96RX0
Gene ID:
Human(957) Summary: The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009]
Mouse(12499) ectonucleoside triphosphate diphosphohydrolase 5
Rat(314312) ectonucleoside triphosphate diphosphohydrolase 5
domestic guinea pig(100721163) ectonucleoside triphosphate diphosphohydrolase 5
naked mole-rat(101703881) ectonucleoside triphosphate diphosphohydrolase 5
sheep(101105824) ectonucleoside triphosphate diphosphohydrolase 5
Domestic Rabbit(100341814) ectonucleoside triphosphate diphosphohydrolase 5
chicken(423343) ectonucleoside triphosphate diphosphohydrolase 5
cow(533096) ectonucleoside triphosphate diphosphohydrolase 5
Horse(100056466) ectonucleoside triphosphate diphosphohydrolase 5
domestic cat(101090270) ectonucleoside triphosphate diphosphohydrolase 5
dog(480384) ectonucleoside triphosphate diphosphohydrolase 5
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1338 Human CD39L4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001249 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001249 Rosetta Predictions human pricing
NM_199394 Rosetta Predictions rat pricing
NM_001026214 Rosetta Predictions mouse pricing
NM_007647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182870 predicted 318
2 SASI_Hs01_00182871 predicted 941
3 SASI_Hs01_00182872 predicted 560
4 SASI_Hs01_00182874 predicted 426
5 SASI_Hs01_00182875 predicted 670
6 SASI_Hs01_00182876 predicted 1033
7 SASI_Hs01_00182877 predicted 335
8 SASI_Hs01_00182878 predicted 378
9 SASI_Hs01_00182879 predicted 640
10 SASI_Hs02_00331424 predicted 644
11 SASI_Hs01_00182873 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074216 predicted 1365
2 SASI_Rn02_00270217 predicted 287
3 SASI_Rn01_00074217 predicted 703
4 SASI_Rn01_00074218 predicted 386
5 SASI_Rn01_00074219 predicted 1506
6 SASI_Rn01_00074220 predicted 1295
7 SASI_Rn02_00270218 predicted 398
8 SASI_Rn01_00074221 predicted 1163
9 SASI_Rn01_00074222 predicted 1344
10 SASI_Rn01_00074223 predicted 726
11 SASI_Rn01_00074224 predicted 1112
12 SASI_Rn01_00074225 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001026214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030550 predicted 1573
2 SASI_Mm01_00030551 predicted 553
3 SASI_Mm01_00030552 predicted 1047
4 SASI_Mm01_00030553 predicted 934
5 SASI_Mm01_00030554 predicted 936
6 SASI_Mm01_00030555 predicted 1125
7 SASI_Mm01_00030556 predicted 1456
8 SASI_Mm01_00030557 predicted 758
9 SASI_Mm01_00030559 predicted 1459
10 SASI_Mm02_00288011 predicted 661
11 SASI_Mm01_00030558 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033038 predicted 1502
2 SASI_Mm01_00033039 predicted 479
3 SASI_Mm01_00033040 predicted 969
4 SASI_Mm01_00033041 predicted 869
5 SASI_Mm01_00033042 predicted 858
6 SASI_Mm01_00033043 predicted 1047
7 SASI_Mm01_00033044 predicted 1375
8 SASI_Mm01_00033045 predicted 683
9 SASI_Mm01_00033047 predicted 1385
10 SASI_Mm02_00312131 predicted 586
11 SASI_Mm01_00033046 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007647
VALIDATED
ENTPD5 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-1165s21c1
Sequence:CCGGCGCCTTCTACGCTTTCTCTTACTCGAGTAAGAGAAAGCGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-695s21c1
Sequence:CCGGGATGGGTCCTATGAAGGCATACTCGAGTATGCCTTCATAGGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-1393s21c1
Sequence:CCGGGCTCACAAAGAAAGTGAACAACTCGAGTTGTTCACTTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-177s21c1
Sequence:CCGGGTCCACATCTTGGGAAGAATACTCGAGTATTCTTCCCAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-2683s1c1
Sequence:CCGGCCCTGCTGAATTTGGCTATTTCTCGAGAAATAGCCAAATTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-1393s1c1
Sequence:CCGGGCTCACAAAGAAAGTGAACAACTCGAGTTGTTCACTTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-177s1c1
Sequence:CCGGGTCCACATCTTGGGAAGAATACTCGAGTATTCTTCCCAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-695s1c1
Sequence:CCGGGATGGGTCCTATGAAGGCATACTCGAGTATGCCTTCATAGGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-1165s1c1
Sequence:CCGGCGCCTTCTACGCTTTCTCTTACTCGAGTAAGAGAAAGCGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007647
VALIDATED
ENTPD5 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-1165s21c1
Sequence:CCGGCGCCTTCTACGCTTTCTCTTACTCGAGTAAGAGAAAGCGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-695s21c1
Sequence:CCGGGATGGGTCCTATGAAGGCATACTCGAGTATGCCTTCATAGGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-1393s21c1
Sequence:CCGGGCTCACAAAGAAAGTGAACAACTCGAGTTGTTCACTTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-177s21c1
Sequence:CCGGGTCCACATCTTGGGAAGAATACTCGAGTATTCTTCCCAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-2683s1c1
Sequence:CCGGCCCTGCTGAATTTGGCTATTTCTCGAGAAATAGCCAAATTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-1393s1c1
Sequence:CCGGGCTCACAAAGAAAGTGAACAACTCGAGTTGTTCACTTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-177s1c1
Sequence:CCGGGTCCACATCTTGGGAAGAATACTCGAGTATTCTTCCCAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-695s1c1
Sequence:CCGGGATGGGTCCTATGAAGGCATACTCGAGTATGCCTTCATAGGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-1165s1c1
Sequence:CCGGCGCCTTCTACGCTTTCTCTTACTCGAGTAAGAGAAAGCGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007647
VALIDATED
ENTPD5 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-1165s21c1
Sequence:CCGGCGCCTTCTACGCTTTCTCTTACTCGAGTAAGAGAAAGCGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-695s21c1
Sequence:CCGGGATGGGTCCTATGAAGGCATACTCGAGTATGCCTTCATAGGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-1393s21c1
Sequence:CCGGGCTCACAAAGAAAGTGAACAACTCGAGTTGTTCACTTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007647.2-177s21c1
Sequence:CCGGGTCCACATCTTGGGAAGAATACTCGAGTATTCTTCCCAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-2683s1c1
Sequence:CCGGCCCTGCTGAATTTGGCTATTTCTCGAGAAATAGCCAAATTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-1393s1c1
Sequence:CCGGGCTCACAAAGAAAGTGAACAACTCGAGTTGTTCACTTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-177s1c1
Sequence:CCGGGTCCACATCTTGGGAAGAATACTCGAGTATTCTTCCCAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-695s1c1
Sequence:CCGGGATGGGTCCTATGAAGGCATACTCGAGTATGCCTTCATAGGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007647.2-1165s1c1
Sequence:CCGGCGCCTTCTACGCTTTCTCTTACTCGAGTAAGAGAAAGCGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001249
VALIDATED
ENTPD5 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-920s21c1
Sequence:CCGGTCACTTCCTTTGAGATGTTTACTCGAGTAAACATCTCAAAGGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001249.1-1632s21c1
Sequence:GTACCGGAGCCTAGAGATTTAGGTTTAACTCGAGTTAAACCTAAATCTCTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-1226s21c1
Sequence:CCGGATGCTTTCTCTTACTATTATGCTCGAGCATAATAGTAAGAGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-752s21c1
Sequence:CCGGGATCCGACGAAGGCATATTAGCTCGAGCTAATATGCCTTCGTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-382s21c1
Sequence:CCGGAGCACCTTGTATGGAATTATGCTCGAGCATAATTCCATACAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001249.1-1399s1c1
Sequence:CCGGGCCCTGTTAAAGGATGGCTTTCTCGAGAAAGCCATCCTTTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-324s1c1
Sequence:CCGGGCAGACTTGGTTTGAGGGTATCTCGAGATACCCTCAAACCAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-379s1c1
Sequence:CCGGGCCAGCACCTTGTATGGAATTCTCGAGAATTCCATACAAGGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001249.1-760s1c1
Sequence:CCGGGAAGGCATATTAGCTTGGGTTCTCGAGAACCCAAGCTAATATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-954s1c1
Sequence:CCGGGCTCTATACACATAGTTACTTCTCGAGAAGTAACTATGTGTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001249
VALIDATED
ENTPD5 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-920s21c1
Sequence:CCGGTCACTTCCTTTGAGATGTTTACTCGAGTAAACATCTCAAAGGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001249.1-1632s21c1
Sequence:GTACCGGAGCCTAGAGATTTAGGTTTAACTCGAGTTAAACCTAAATCTCTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-1226s21c1
Sequence:CCGGATGCTTTCTCTTACTATTATGCTCGAGCATAATAGTAAGAGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-752s21c1
Sequence:CCGGGATCCGACGAAGGCATATTAGCTCGAGCTAATATGCCTTCGTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-382s21c1
Sequence:CCGGAGCACCTTGTATGGAATTATGCTCGAGCATAATTCCATACAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001249.1-1399s1c1
Sequence:CCGGGCCCTGTTAAAGGATGGCTTTCTCGAGAAAGCCATCCTTTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-324s1c1
Sequence:CCGGGCAGACTTGGTTTGAGGGTATCTCGAGATACCCTCAAACCAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-379s1c1
Sequence:CCGGGCCAGCACCTTGTATGGAATTCTCGAGAATTCCATACAAGGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001249.1-760s1c1
Sequence:CCGGGAAGGCATATTAGCTTGGGTTCTCGAGAACCCAAGCTAATATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-954s1c1
Sequence:CCGGGCTCTATACACATAGTTACTTCTCGAGAAGTAACTATGTGTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001249
VALIDATED
ENTPD5 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-920s21c1
Sequence:CCGGTCACTTCCTTTGAGATGTTTACTCGAGTAAACATCTCAAAGGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001249.1-1632s21c1
Sequence:GTACCGGAGCCTAGAGATTTAGGTTTAACTCGAGTTAAACCTAAATCTCTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-1226s21c1
Sequence:CCGGATGCTTTCTCTTACTATTATGCTCGAGCATAATAGTAAGAGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-752s21c1
Sequence:CCGGGATCCGACGAAGGCATATTAGCTCGAGCTAATATGCCTTCGTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001249.1-382s21c1
Sequence:CCGGAGCACCTTGTATGGAATTATGCTCGAGCATAATTCCATACAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001249.1-1399s1c1
Sequence:CCGGGCCCTGTTAAAGGATGGCTTTCTCGAGAAAGCCATCCTTTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-324s1c1
Sequence:CCGGGCAGACTTGGTTTGAGGGTATCTCGAGATACCCTCAAACCAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-379s1c1
Sequence:CCGGGCCAGCACCTTGTATGGAATTCTCGAGAATTCCATACAAGGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001249.1-760s1c1
Sequence:CCGGGAAGGCATATTAGCTTGGGTTCTCGAGAACCCAAGCTAATATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001249.1-954s1c1
Sequence:CCGGGCTCTATACACATAGTTACTTCTCGAGAAGTAACTATGTGTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks