EMAIL THIS PAGE TO A FRIEND

ENTPD6

ectonucleoside triphosphate diphosphohydrolase 6 (putative)

81 Gene Product Result for
Synonyms: CD39L2 IL-6SAG IL6ST2 NTPDase-6 dJ738P15.3
UniProtKB ID: O75354, Q5QPJ5, Q7Z5B5, Q8N3H3, Q8TAS7, Q9UJD1
Gene ID:
Human(955) Summary: ENTPD6 is similar to E-type nucleotidases (NTPases). NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD6 contains 4 apyrase-conserved regions which is characteristic of NTPases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12497) ectonucleoside triphosphate diphosphohydrolase 6
Rat(85260) ectonucleoside triphosphate diphosphohydrolase 6
Zebrafish(550560) ectonucleoside triphosphate diphosphohydrolase 6 (putative function)
chicken(416708) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Horse(100057043) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
cow(508097) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
domestic cat(101090852) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
dog(485564) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
sheep(101104845) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Domestic Rabbit(100342665) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
naked mole-rat(101717001) ectonucleoside triphosphate diphosphohydrolase 6 (putative)
domestic guinea pig(100379248) ectonucleoside triphosphate diphosphohydrolase 6
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1337 Human CD39L2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001247 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114089 Rosetta Predictions human pricing
NM_001247 Rosetta Predictions human pricing
NM_053498 Rosetta Predictions rat pricing
NM_172117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326154 predicted 1555
2 SASI_Hs02_00326155 predicted 754
3 SASI_Hs02_00326156 predicted 536
4 SASI_Hs02_00326157 predicted 478
5 SASI_Hs02_00326158 predicted 406
6 SASI_Hs02_00326159 predicted 488
7 SASI_Hs02_00326160 predicted 947
8 SASI_Hs02_00326161 predicted 443
9 SASI_Hs02_00326162 predicted 964
10 SASI_Hs02_00326163 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203491 predicted 1619
2 SASI_Hs01_00203492 predicted 822
3 SASI_Hs01_00203493 predicted 609
4 SASI_Hs01_00203494 predicted 544
5 SASI_Hs01_00203495 predicted 469
6 SASI_Hs01_00203496 predicted 565
7 SASI_Hs01_00203497 predicted 1013
8 SASI_Hs01_00203498 predicted 514
9 SASI_Hs01_00203499 predicted 1030
10 SASI_Hs01_00203500 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063257 predicted 648
2 SASI_Rn01_00063258 predicted 893
3 SASI_Rn02_00266105 predicted 202
4 SASI_Rn01_00063259 predicted 714
5 SASI_Rn01_00063260 predicted 1205
6 SASI_Rn01_00063261 predicted 337
7 SASI_Rn01_00063262 predicted 1129
8 SASI_Rn01_00063263 predicted 1119
9 SASI_Rn01_00063264 predicted 1070
10 SASI_Rn02_00266106 predicted 532
11 SASI_Rn01_00063255 predicted 196
12 SASI_Rn01_00063256 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343653 predicted 251
2 SASI_Mm02_00343654 predicted 949
3 SASI_Mm02_00343655 predicted 764
4 SASI_Mm02_00343656 predicted 1116
5 SASI_Mm01_00131293 predicted 1267
6 SASI_Mm01_00131294 predicted 586
7 SASI_Mm01_00131295 predicted 1295
8 SASI_Mm01_00131296 predicted 579
9 SASI_Mm01_00131300 predicted 700
10 SASI_Mm01_00131299 predicted 1132
11 SASI_Mm01_00131292 predicted 684
12 SASI_Mm01_00131297 predicted 1039
13 SASI_Mm01_00131298 predicted 435
14 SASI_Mm01_00131301 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172117
VALIDATED
ENTPD6 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-1042s1c1
Sequence:CCGGCCAGAATCTCATGCCAAGAGACTCGAGTCTCTTGGCATGAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-520s1c1
Sequence:CCGGGCTTACGCTGATGATGTTGAACTCGAGTTCAACATCATCAGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-376s1c1
Sequence:CCGGCGTGGTCATGAGGTCTTCTATCTCGAGATAGAAGACCTCATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-246s1c1
Sequence:CCGGCCTGTTCATCTATGTTGCCTACTCGAGTAGGCAACATAGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-577s1c1
Sequence:CCGGGCTAAGCAACACATTCCTTATCTCGAGATAAGGAATGTGTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-531s21c1
Sequence:CCGGGCTTACGCTGATGATGTTGAACTCGAGTTCAACATCATCAGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-588s21c1
Sequence:CCGGGCTAAGCAACACATTCCTTATCTCGAGATAAGGAATGTGTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-257s21c1
Sequence:CCGGCCTGTTCATCTATGTTGCCTACTCGAGTAGGCAACATAGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-387s21c1
Sequence:CCGGCGTGGTCATGAGGTCTTCTATCTCGAGATAGAAGACCTCATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172117
VALIDATED
ENTPD6 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-1042s1c1
Sequence:CCGGCCAGAATCTCATGCCAAGAGACTCGAGTCTCTTGGCATGAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-520s1c1
Sequence:CCGGGCTTACGCTGATGATGTTGAACTCGAGTTCAACATCATCAGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-376s1c1
Sequence:CCGGCGTGGTCATGAGGTCTTCTATCTCGAGATAGAAGACCTCATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-246s1c1
Sequence:CCGGCCTGTTCATCTATGTTGCCTACTCGAGTAGGCAACATAGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-577s1c1
Sequence:CCGGGCTAAGCAACACATTCCTTATCTCGAGATAAGGAATGTGTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-531s21c1
Sequence:CCGGGCTTACGCTGATGATGTTGAACTCGAGTTCAACATCATCAGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-588s21c1
Sequence:CCGGGCTAAGCAACACATTCCTTATCTCGAGATAAGGAATGTGTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-257s21c1
Sequence:CCGGCCTGTTCATCTATGTTGCCTACTCGAGTAGGCAACATAGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-387s21c1
Sequence:CCGGCGTGGTCATGAGGTCTTCTATCTCGAGATAGAAGACCTCATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172117
VALIDATED
ENTPD6 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-1042s1c1
Sequence:CCGGCCAGAATCTCATGCCAAGAGACTCGAGTCTCTTGGCATGAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-520s1c1
Sequence:CCGGGCTTACGCTGATGATGTTGAACTCGAGTTCAACATCATCAGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-376s1c1
Sequence:CCGGCGTGGTCATGAGGTCTTCTATCTCGAGATAGAAGACCTCATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-246s1c1
Sequence:CCGGCCTGTTCATCTATGTTGCCTACTCGAGTAGGCAACATAGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172117.1-577s1c1
Sequence:CCGGGCTAAGCAACACATTCCTTATCTCGAGATAAGGAATGTGTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-531s21c1
Sequence:CCGGGCTTACGCTGATGATGTTGAACTCGAGTTCAACATCATCAGCGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-588s21c1
Sequence:CCGGGCTAAGCAACACATTCCTTATCTCGAGATAAGGAATGTGTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-257s21c1
Sequence:CCGGCCTGTTCATCTATGTTGCCTACTCGAGTAGGCAACATAGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172117.5-387s21c1
Sequence:CCGGCGTGGTCATGAGGTCTTCTATCTCGAGATAGAAGACCTCATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001247
VALIDATED
ENTPD6 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-987s1c1
Sequence:CCGGGCGGATGTTTAACAGGACCTACTCGAGTAGGTCCTGTTAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-738s1c1
Sequence:CCGGGCAGAAGGTGAAAGAAGTATTCTCGAGAATACTTCTTTCACCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001247.1-578s1c1
Sequence:CCGGCCTATGCTGATGATGTTGAAACTCGAGTTTCAACATCATCAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-298s1c1
Sequence:CCGGGTGGGCGTGTTCATCTATGTTCTCGAGAACATAGATGAACACGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-518s1c1
Sequence:CCGGCCAGAGAAACTCCCACGTTAACTCGAGTTAACGTGGGAGTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-652s21c1
Sequence:GTACCGGGAACTACTGGATGTTGCTAAACTCGAGTTTAGCAACATCCAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-1020s21c1
Sequence:CCGGGCGGATGTTTAACAGGACCTACTCGAGTAGGTCCTGTTAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-771s21c1
Sequence:CCGGGCAGAAGGTGAAAGAAGTATTCTCGAGAATACTTCTTTCACCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-611s21c1
Sequence:CCGGCCTATGCTGATGATGTTGAAACTCGAGTTTCAACATCATCAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-331s21c1
Sequence:CCGGGTGGGCGTGTTCATCTATGTTCTCGAGAACATAGATGAACACGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-552s21c1
Sequence:GTACCGGCAGAGAAACTCCCACGTTAACCTCGAGGTTAACGTGGGAGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-1301s21c1
Sequence:GTACCGGTGAAGCATGTGGACTTCTATGCTCGAGCATAGAAGTCCACATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001247
VALIDATED
ENTPD6 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-987s1c1
Sequence:CCGGGCGGATGTTTAACAGGACCTACTCGAGTAGGTCCTGTTAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-738s1c1
Sequence:CCGGGCAGAAGGTGAAAGAAGTATTCTCGAGAATACTTCTTTCACCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001247.1-578s1c1
Sequence:CCGGCCTATGCTGATGATGTTGAAACTCGAGTTTCAACATCATCAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-298s1c1
Sequence:CCGGGTGGGCGTGTTCATCTATGTTCTCGAGAACATAGATGAACACGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-518s1c1
Sequence:CCGGCCAGAGAAACTCCCACGTTAACTCGAGTTAACGTGGGAGTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-652s21c1
Sequence:GTACCGGGAACTACTGGATGTTGCTAAACTCGAGTTTAGCAACATCCAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-1020s21c1
Sequence:CCGGGCGGATGTTTAACAGGACCTACTCGAGTAGGTCCTGTTAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-771s21c1
Sequence:CCGGGCAGAAGGTGAAAGAAGTATTCTCGAGAATACTTCTTTCACCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-611s21c1
Sequence:CCGGCCTATGCTGATGATGTTGAAACTCGAGTTTCAACATCATCAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-331s21c1
Sequence:CCGGGTGGGCGTGTTCATCTATGTTCTCGAGAACATAGATGAACACGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-552s21c1
Sequence:GTACCGGCAGAGAAACTCCCACGTTAACCTCGAGGTTAACGTGGGAGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-1301s21c1
Sequence:GTACCGGTGAAGCATGTGGACTTCTATGCTCGAGCATAGAAGTCCACATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001247
VALIDATED
ENTPD6 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-987s1c1
Sequence:CCGGGCGGATGTTTAACAGGACCTACTCGAGTAGGTCCTGTTAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-738s1c1
Sequence:CCGGGCAGAAGGTGAAAGAAGTATTCTCGAGAATACTTCTTTCACCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001247.1-578s1c1
Sequence:CCGGCCTATGCTGATGATGTTGAAACTCGAGTTTCAACATCATCAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-298s1c1
Sequence:CCGGGTGGGCGTGTTCATCTATGTTCTCGAGAACATAGATGAACACGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001247.1-518s1c1
Sequence:CCGGCCAGAGAAACTCCCACGTTAACTCGAGTTAACGTGGGAGTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-652s21c1
Sequence:GTACCGGGAACTACTGGATGTTGCTAAACTCGAGTTTAGCAACATCCAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-1020s21c1
Sequence:CCGGGCGGATGTTTAACAGGACCTACTCGAGTAGGTCCTGTTAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-771s21c1
Sequence:CCGGGCAGAAGGTGAAAGAAGTATTCTCGAGAATACTTCTTTCACCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-611s21c1
Sequence:CCGGCCTATGCTGATGATGTTGAAACTCGAGTTTCAACATCATCAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001247.2-331s21c1
Sequence:CCGGGTGGGCGTGTTCATCTATGTTCTCGAGAACATAGATGAACACGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-552s21c1
Sequence:GTACCGGCAGAGAAACTCCCACGTTAACCTCGAGGTTAACGTGGGAGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001247.2-1301s21c1
Sequence:GTACCGGTGAAGCATGTGGACTTCTATGCTCGAGCATAGAAGTCCACATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks