EMAIL THIS PAGE TO A FRIEND

ENTPD7

ectonucleoside triphosphate diphosphohydrolase 7

113 Gene Product Result for
Synonyms: LALP1 RP11-483F11.1
UniProtKB ID: Q9NQZ7, B2RB83, B3KP21, D3DR64
Gene ID:
Mouse(93685) ectonucleoside triphosphate diphosphohydrolase 7
Rat(309390) ectonucleoside triphosphate diphosphohydrolase 7
domestic guinea pig(100718279) ectonucleoside triphosphate diphosphohydrolase 7
naked mole-rat(101717246) ectonucleoside triphosphate diphosphohydrolase 7
sheep(101119006) ectonucleoside triphosphate diphosphohydrolase 7
chicken(430337) ectonucleoside triphosphate diphosphohydrolase 7
domestic cat(101089720) ectonucleoside triphosphate diphosphohydrolase 7
dog(608065) ectonucleoside triphosphate diphosphohydrolase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020354 Rosetta Predictions human pricing
NM_001107595 Rosetta Predictions rat pricing
NM_053103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121841 predicted 831
2 SASI_Hs01_00121842 predicted 2068
3 SASI_Hs01_00121843 predicted 1085
4 SASI_Hs01_00121844 predicted 1889
5 SASI_Hs01_00121845 predicted 606
6 SASI_Hs01_00121846 predicted 1540
7 SASI_Hs01_00121847 predicted 1543
8 SASI_Hs01_00121848 predicted 1378
9 SASI_Hs01_00121849 predicted 340
10 SASI_Hs01_00121850 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230385 predicted 1175
2 SASI_Rn02_00230386 predicted 1019
3 SASI_Rn02_00230387 predicted 1366
4 SASI_Rn02_00230388 predicted 1238
5 SASI_Rn02_00230389 predicted 1203
6 SASI_Rn02_00230390 predicted 947
7 SASI_Rn02_00230391 predicted 1409
8 SASI_Rn02_00230392 predicted 1000
9 SASI_Rn02_00230393 predicted 1331
10 SASI_Rn02_00230394 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043701 predicted 970
2 SASI_Mm01_00043702 predicted 828
3 SASI_Mm01_00043703 predicted 1543
4 SASI_Mm01_00043704 predicted 1267
5 SASI_Mm01_00043705 predicted 1084
6 SASI_Mm01_00043706 predicted 1371
7 SASI_Mm02_00337607 predicted 1091
8 SASI_Mm01_00043707 predicted 1155
9 SASI_Mm01_00043708 predicted 1141
10 SASI_Mm01_00043709 predicted 355
11 SASI_Mm01_00043710 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053103
VALIDATED
ENTPD7 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053103.4-2155s21c1
Sequence:CCGGCCTCTTCTCAGAAGTCGCAATCTCGAGATTGCGACTTCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-1399s21c1
Sequence:CCGGCGACTTCAACAACAGCGAGTTCTCGAGAACTCGCTGTTGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053103.4-2620s21c1
Sequence:CCGGCGCCTTTGAAATGGATGACTTCTCGAGAAGTCATCCATTTCAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-1208s21c1
Sequence:CCGGCTGAGTCCTGACAATCCCTTTCTCGAGAAAGGGATTGTCAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-730s21c1
Sequence:CCGGGTTGGCTATCTTGGCAGATTTCTCGAGAAATCTGCCAAGATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-724s1c1
Sequence:CCGGGTTGGCTATCTTGGCAGATTTCTCGAGAAATCTGCCAAGATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-1202s1c1
Sequence:CCGGCTGAGTCCTGACAATCCCTTTCTCGAGAAAGGGATTGTCAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-1393s1c1
Sequence:CCGGCGACTTCAACAACAGCGAGTTCTCGAGAACTCGCTGTTGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-2613s1c1
Sequence:CCGGCGCCTTTGAAATGGATGACTTCTCGAGAAGTCATCCATTTCAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-2147s1c1
Sequence:CCGGCCTCTTCTCAGAAGTCGCAATCTCGAGATTGCGACTTCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053103
VALIDATED
ENTPD7 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053103.4-2155s21c1
Sequence:CCGGCCTCTTCTCAGAAGTCGCAATCTCGAGATTGCGACTTCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-1399s21c1
Sequence:CCGGCGACTTCAACAACAGCGAGTTCTCGAGAACTCGCTGTTGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053103.4-2620s21c1
Sequence:CCGGCGCCTTTGAAATGGATGACTTCTCGAGAAGTCATCCATTTCAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-1208s21c1
Sequence:CCGGCTGAGTCCTGACAATCCCTTTCTCGAGAAAGGGATTGTCAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-730s21c1
Sequence:CCGGGTTGGCTATCTTGGCAGATTTCTCGAGAAATCTGCCAAGATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-724s1c1
Sequence:CCGGGTTGGCTATCTTGGCAGATTTCTCGAGAAATCTGCCAAGATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-1202s1c1
Sequence:CCGGCTGAGTCCTGACAATCCCTTTCTCGAGAAAGGGATTGTCAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-1393s1c1
Sequence:CCGGCGACTTCAACAACAGCGAGTTCTCGAGAACTCGCTGTTGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-2613s1c1
Sequence:CCGGCGCCTTTGAAATGGATGACTTCTCGAGAAGTCATCCATTTCAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-2147s1c1
Sequence:CCGGCCTCTTCTCAGAAGTCGCAATCTCGAGATTGCGACTTCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053103
VALIDATED
ENTPD7 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053103.4-2155s21c1
Sequence:CCGGCCTCTTCTCAGAAGTCGCAATCTCGAGATTGCGACTTCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-1399s21c1
Sequence:CCGGCGACTTCAACAACAGCGAGTTCTCGAGAACTCGCTGTTGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053103.4-2620s21c1
Sequence:CCGGCGCCTTTGAAATGGATGACTTCTCGAGAAGTCATCCATTTCAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-1208s21c1
Sequence:CCGGCTGAGTCCTGACAATCCCTTTCTCGAGAAAGGGATTGTCAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053103.4-730s21c1
Sequence:CCGGGTTGGCTATCTTGGCAGATTTCTCGAGAAATCTGCCAAGATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-724s1c1
Sequence:CCGGGTTGGCTATCTTGGCAGATTTCTCGAGAAATCTGCCAAGATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-1202s1c1
Sequence:CCGGCTGAGTCCTGACAATCCCTTTCTCGAGAAAGGGATTGTCAGGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-1393s1c1
Sequence:CCGGCGACTTCAACAACAGCGAGTTCTCGAGAACTCGCTGTTGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-2613s1c1
Sequence:CCGGCGCCTTTGAAATGGATGACTTCTCGAGAAGTCATCCATTTCAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053103.2-2147s1c1
Sequence:CCGGCCTCTTCTCAGAAGTCGCAATCTCGAGATTGCGACTTCTGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020354
VALIDATED
ENTPD7 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020354.3-1478s21c1
Sequence:CCGGCGCTACCATGGGCCAACATTTCTCGAGAAATGTTGGCCCATGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-1581s21c1
Sequence:CCGGCAGATGAGCATCGACTCAAATCTCGAGATTTGAGTCGATGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-2202s21c1
Sequence:CCGGACAGGAGATTGGTGCTAATACCTCGAGGTATTAGCACCAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-2119s21c1
Sequence:CCGGACTTTACTTTCTACCGTAATTCTCGAGAATTACGGTAGAAAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020354.1-1545s1c1
Sequence:CCGGGCAGATGAGCATCGACTCAAACTCGAGTTTGAGTCGATGCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020354.1-1182s1c1
Sequence:CCGGCCCGACAATCCATTTCTGGATCTCGAGATCCAGAAATGGATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020354.1-312s1c1
Sequence:CCGGCCACGAGATAGGCAATACGAACTCGAGTTCGTATTGCCTATCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020354.1-804s1c1
Sequence:CCGGGCATGGATTGGAATCAACTTTCTCGAGAAAGTTGATTCCAATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020354.1-1584s1c1
Sequence:CCGGGCTTGGATGTACCAAGTCTTACTCGAGTAAGACTTGGTACATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020354
VALIDATED
ENTPD7 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020354.3-1478s21c1
Sequence:CCGGCGCTACCATGGGCCAACATTTCTCGAGAAATGTTGGCCCATGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-1581s21c1
Sequence:CCGGCAGATGAGCATCGACTCAAATCTCGAGATTTGAGTCGATGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-2202s21c1
Sequence:CCGGACAGGAGATTGGTGCTAATACCTCGAGGTATTAGCACCAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-2119s21c1
Sequence:CCGGACTTTACTTTCTACCGTAATTCTCGAGAATTACGGTAGAAAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020354.1-1545s1c1
Sequence:CCGGGCAGATGAGCATCGACTCAAACTCGAGTTTGAGTCGATGCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020354.1-1182s1c1
Sequence:CCGGCCCGACAATCCATTTCTGGATCTCGAGATCCAGAAATGGATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020354.1-312s1c1
Sequence:CCGGCCACGAGATAGGCAATACGAACTCGAGTTCGTATTGCCTATCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020354.1-804s1c1
Sequence:CCGGGCATGGATTGGAATCAACTTTCTCGAGAAAGTTGATTCCAATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020354.1-1584s1c1
Sequence:CCGGGCTTGGATGTACCAAGTCTTACTCGAGTAAGACTTGGTACATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020354
VALIDATED
ENTPD7 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020354.3-1478s21c1
Sequence:CCGGCGCTACCATGGGCCAACATTTCTCGAGAAATGTTGGCCCATGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-1581s21c1
Sequence:CCGGCAGATGAGCATCGACTCAAATCTCGAGATTTGAGTCGATGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-2202s21c1
Sequence:CCGGACAGGAGATTGGTGCTAATACCTCGAGGTATTAGCACCAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020354.3-2119s21c1
Sequence:CCGGACTTTACTTTCTACCGTAATTCTCGAGAATTACGGTAGAAAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020354.1-1545s1c1
Sequence:CCGGGCAGATGAGCATCGACTCAAACTCGAGTTTGAGTCGATGCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020354.1-1182s1c1
Sequence:CCGGCCCGACAATCCATTTCTGGATCTCGAGATCCAGAAATGGATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020354.1-312s1c1
Sequence:CCGGCCACGAGATAGGCAATACGAACTCGAGTTCGTATTGCCTATCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020354.1-804s1c1
Sequence:CCGGGCATGGATTGGAATCAACTTTCTCGAGAAAGTTGATTCCAATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020354.1-1584s1c1
Sequence:CCGGGCTTGGATGTACCAAGTCTTACTCGAGTAAGACTTGGTACATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks