EMAIL THIS PAGE TO A FRIEND

ENTPD8

ectonucleoside triphosphate diphosphohydrolase 8

111 Gene Product Result for
Synonyms: GLSR2492 NTPDase-8 UNQ2492
UniProtKB ID: Q5MY95, A2BG17, Q6UVZ0
Gene ID:
Mouse(72090) ectonucleoside triphosphate diphosphohydrolase 8
Rat(613267) ectonucleoside triphosphate diphosphohydrolase 8
Zebrafish(436652) ectonucleoside triphosphate diphosphohydrolase 8
domestic cat(101085582) ectonucleoside triphosphate diphosphohydrolase 8
cow(515532) ectonucleoside triphosphate diphosphohydrolase 8
Horse(100058558) ectonucleoside triphosphate diphosphohydrolase 8
dog(100688937) ectonucleoside triphosphate diphosphohydrolase 8
chicken(374095) ectonucleoside triphosphate diphosphohydrolase 8
Domestic Rabbit(100349881) ectonucleoside triphosphate diphosphohydrolase 8
naked mole-rat(101708535) ectonucleoside triphosphate diphosphohydrolase 8
domestic guinea pig(100727694) ectonucleoside triphosphate diphosphohydrolase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198585 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036331 MISSION® esiRNA esiRNA human ENTPD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033113 Rosetta Predictions human pricing
NM_198585 Rosetta Predictions human pricing
NM_001033565 Rosetta Predictions rat pricing
NM_028093 Rosetta Predictions mouse pricing
XM_619737 Rosetta Predictions mouse pricing
XM_976205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308009 predicted 690
2 SASI_Hs02_00308010 predicted 721
3 SASI_Hs02_00308011 predicted 997
4 SASI_Hs02_00308012 predicted 892
5 SASI_Hs02_00308013 predicted 252
6 SASI_Hs02_00308014 predicted 869
7 SASI_Hs02_00308015 predicted 439
8 SASI_Hs02_00308016 predicted 425
9 SASI_Hs02_00308017 predicted 1826
10 SASI_Hs02_00308018 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372234 predicted 690
2 SASI_Hs01_00051128 predicted 724
3 SASI_Hs01_00051129 predicted 996
4 SASI_Hs01_00051131 predicted 887
5 SASI_Hs02_00372235 predicted 250
6 SASI_Hs01_00051132 predicted 866
7 SASI_Hs01_00051133 predicted 432
8 SASI_Hs01_00051134 predicted 425
9 SASI_Hs01_00051136 predicted 1708
10 SASI_Hs01_00051137 predicted 1554
11 SASI_Hs01_00051130 predicted 1103
12 SASI_Hs01_00051135 predicted 1861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063815 predicted 1244
2 SASI_Rn01_00063816 predicted 911
3 SASI_Rn01_00063818 predicted 1211
4 SASI_Rn01_00063819 predicted 545
5 SASI_Rn02_00203647 predicted 881
6 SASI_Rn01_00063820 predicted 700
7 SASI_Rn02_00203648 predicted 510
8 SASI_Rn01_00063822 predicted 999
9 SASI_Rn01_00063823 predicted 695
10 SASI_Rn02_00203649 predicted 570
11 SASI_Rn01_00063817 predicted 1277
12 SASI_Rn01_00063821 predicted 253
13 SASI_Rn01_00063824 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333330 predicted 1490
2 SASI_Mm02_00333331 predicted 1095
3 SASI_Mm02_00333332 predicted 1755
4 SASI_Mm02_00333333 predicted 1797
5 SASI_Mm02_00333334 predicted 1778
6 SASI_Mm02_00333335 predicted 1243
7 SASI_Mm02_00333336 predicted 487
8 SASI_Mm02_00333337 predicted 1759
9 SASI_Mm02_00333338 predicted 503
10 SASI_Mm02_00333339 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203923 predicted 490
2 SASI_Mm01_00203924 predicted 468
3 SASI_Mm01_00203925 predicted 461
4 SASI_Mm01_00203926 predicted 485
5 SASI_Mm01_00203927 predicted 465
6 SASI_Mm01_00203928 predicted 457
7 SASI_Mm01_00203929 predicted 498
8 SASI_Mm01_00203930 predicted 468
9 SASI_Mm01_00203931 predicted 471
10 SASI_Mm01_00203932 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210893 predicted 487
2 SASI_Mm01_00210894 predicted 464
3 SASI_Mm01_00210895 predicted 1634
4 SASI_Mm01_00210896 predicted 471
5 SASI_Mm01_00210897 predicted 463
6 SASI_Mm01_00210898 predicted 1660
7 SASI_Mm01_00210899 predicted 459
8 SASI_Mm01_00210900 predicted 1649
9 SASI_Mm01_00210901 predicted 499
10 SASI_Mm01_00210902 predicted 1648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198585
ENTPD8 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-298s1c1
Sequence:CCGGCACAGACATCAAGTTTGGGATCTCGAGATCCCAAACTTGATGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-1408s1c1
Sequence:CCGGGCTGAACCTGACCGGGATGATCTCGAGATCATCCCGGTCAGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-304s1c1
Sequence:CCGGCATCAAGTTTGGGATCGTGTTCTCGAGAACACGATCCCAAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-697s1c1
Sequence:CCGGTGGTTGGATCACTGTCAACTACTCGAGTAGTTGACAGTGATCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-905s1c1
Sequence:CCGGACTCACAGCTACCTGTGCTTTCTCGAGAAAGCACAGGTAGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-739s21c1
Sequence:CCGGGTACTCCTTCACTGGAGAATGCTCGAGCATTCTCCAGTGAAGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-358s21c1
Sequence:CCGGGTATCAGTGGCTGGCGAACAACTCGAGTTGTTCGCCAGCCACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-306s21c1
Sequence:CCGGTCAAGTTTGGGATCGTGTTTGCTCGAGCAAACACGATCCCAAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-437s21c1
Sequence:CCGGATCTCCTCCTACACTTCTAATCTCGAGATTAGAAGTGTAGGAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198585
ENTPD8 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-298s1c1
Sequence:CCGGCACAGACATCAAGTTTGGGATCTCGAGATCCCAAACTTGATGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-1408s1c1
Sequence:CCGGGCTGAACCTGACCGGGATGATCTCGAGATCATCCCGGTCAGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-304s1c1
Sequence:CCGGCATCAAGTTTGGGATCGTGTTCTCGAGAACACGATCCCAAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-697s1c1
Sequence:CCGGTGGTTGGATCACTGTCAACTACTCGAGTAGTTGACAGTGATCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-905s1c1
Sequence:CCGGACTCACAGCTACCTGTGCTTTCTCGAGAAAGCACAGGTAGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-739s21c1
Sequence:CCGGGTACTCCTTCACTGGAGAATGCTCGAGCATTCTCCAGTGAAGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-358s21c1
Sequence:CCGGGTATCAGTGGCTGGCGAACAACTCGAGTTGTTCGCCAGCCACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-306s21c1
Sequence:CCGGTCAAGTTTGGGATCGTGTTTGCTCGAGCAAACACGATCCCAAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-437s21c1
Sequence:CCGGATCTCCTCCTACACTTCTAATCTCGAGATTAGAAGTGTAGGAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198585
ENTPD8 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-298s1c1
Sequence:CCGGCACAGACATCAAGTTTGGGATCTCGAGATCCCAAACTTGATGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-1408s1c1
Sequence:CCGGGCTGAACCTGACCGGGATGATCTCGAGATCATCCCGGTCAGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-304s1c1
Sequence:CCGGCATCAAGTTTGGGATCGTGTTCTCGAGAACACGATCCCAAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-697s1c1
Sequence:CCGGTGGTTGGATCACTGTCAACTACTCGAGTAGTTGACAGTGATCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198585.1-905s1c1
Sequence:CCGGACTCACAGCTACCTGTGCTTTCTCGAGAAAGCACAGGTAGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-739s21c1
Sequence:CCGGGTACTCCTTCACTGGAGAATGCTCGAGCATTCTCCAGTGAAGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-358s21c1
Sequence:CCGGGTATCAGTGGCTGGCGAACAACTCGAGTTGTTCGCCAGCCACTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-306s21c1
Sequence:CCGGTCAAGTTTGGGATCGTGTTTGCTCGAGCAAACACGATCCCAAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198585.2-437s21c1
Sequence:CCGGATCTCCTCCTACACTTCTAATCTCGAGATTAGAAGTGTAGGAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028093
ENTPD8 MISSION shRNA Bacterial Glycerol Stock
ectonucleoside triphosphate diphosphohydrolase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-328s21c1
Sequence:CCGGTCCTGGTGAAGGCAATCAATGCTCGAGCATTGATTGCCTTCACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-1466s21c1
Sequence:CCGGGGGTCTGTACATCCTCGTATTCTCGAGAATACGAGGATGTACAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028093.1-2108s21c1
Sequence:CCGGTCCCTGCTTCCTCACTATATCCTCGAGGATATAGTGAGGAAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-1652s21c1
Sequence:CCGGCTGGACGGCTGGAGTAGTATTCTCGAGAATACTACTCCAGCCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-760s21c1
Sequence:CCGGGTTGGATCACCATCAACTATGCTCGAGCATAGTTGATGGTGATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028093
ENTPD8 MISSION shRNA shRNA Plasmid DNA
ectonucleoside triphosphate diphosphohydrolase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-328s21c1
Sequence:CCGGTCCTGGTGAAGGCAATCAATGCTCGAGCATTGATTGCCTTCACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-1466s21c1
Sequence:CCGGGGGTCTGTACATCCTCGTATTCTCGAGAATACGAGGATGTACAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028093.1-2108s21c1
Sequence:CCGGTCCCTGCTTCCTCACTATATCCTCGAGGATATAGTGAGGAAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-1652s21c1
Sequence:CCGGCTGGACGGCTGGAGTAGTATTCTCGAGAATACTACTCCAGCCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-760s21c1
Sequence:CCGGGTTGGATCACCATCAACTATGCTCGAGCATAGTTGATGGTGATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028093
ENTPD8 MISSION shRNA Lentiviral Transduction Particles
ectonucleoside triphosphate diphosphohydrolase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-328s21c1
Sequence:CCGGTCCTGGTGAAGGCAATCAATGCTCGAGCATTGATTGCCTTCACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-1466s21c1
Sequence:CCGGGGGTCTGTACATCCTCGTATTCTCGAGAATACGAGGATGTACAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028093.1-2108s21c1
Sequence:CCGGTCCCTGCTTCCTCACTATATCCTCGAGGATATAGTGAGGAAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-1652s21c1
Sequence:CCGGCTGGACGGCTGGAGTAGTATTCTCGAGAATACTACTCCAGCCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028093.1-760s21c1
Sequence:CCGGGTTGGATCACCATCAACTATGCTCGAGCATAGTTGATGGTGATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks